Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Mouse c-myc (exons II and III)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pSP64; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8455630
Proper citation: RRID:Addgene_8448 Copy
Species: Mus musculus
Genetic Insert: Srap1
Vector Backbone Description: Backbone Marker:Millipore; Backbone Size:5400; Vector Backbone:pET30a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29020633
Proper citation: RRID:Addgene_84568 Copy
Species: Mus musculus
Genetic Insert: FLAG tag, Suntag, oxBFP, Auxin-inducible degron, beta-actin 3'UTR, MS2V5 stem-loops
Vector Backbone Description: Backbone Size:6255; Vector Backbone:pUbC lentivirus expression vector (2nd generation); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27313041
Proper citation: RRID:Addgene_84561 Copy
Species: Mus musculus
Genetic Insert: FBP30?
Vector Backbone Description: Backbone Size:0; Vector Backbone:na; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10744724
Comments: (Leder #C-1093)
Proper citation: RRID:Addgene_8461 Copy
Species: Mus musculus
Genetic Insert: siTwist
Vector Backbone Description: Backbone Size:9439; Vector Backbone:pSP-108; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15210113
Comments: Twist-siRNA7-targetting sequence is AGCGGGTCATGGCTAACGTGC
Proper citation: RRID:Addgene_8457 Copy
Species: Mus musculus
Genetic Insert: siTwist
Vector Backbone Description: Backbone Size:9439; Vector Backbone:pSP-108; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15210113
Comments: Twist-siRNA5-targetting sequence is AGGTACATCGACTTCCTGTAC
Proper citation: RRID:Addgene_8456 Copy
Species: Mus musculus
Genetic Insert: HOXA9
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9343407
Comments: See author's map.
Proper citation: RRID:Addgene_8494 Copy
Species: Mus musculus
Genetic Insert: HoxA9
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9343407
Comments: Deborah Wolgemuth
Proper citation: RRID:Addgene_8493 Copy
Species: Mus musculus
Genetic Insert: Multicloning sites and selection cassette
Vector Backbone Description: Backbone Marker:agilent; Backbone Size:4650; Vector Backbone:pAAV-MCS; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27264994
Comments: Sequencing over ITR sequences may be difficult. We used additional internal sequencing primers
Proper citation: RRID:Addgene_84883 Copy
Species: Mus musculus
Genetic Insert: HOXA9
Vector Backbone Description: Backbone Size:0; Vector Backbone:MIG (MSCV IRES GFP); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9343407
Comments: Note: Addgene verified sequence confirms that the FLAG sequence is DYKDDDDK.
Proper citation: RRID:Addgene_8515 Copy
Species: Mus musculus
Genetic Insert: HOXA9
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pRC/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9343407
Comments: this clone lacks most of the long 3'UTR from the longest Hoxa9 gene transcript
Proper citation: RRID:Addgene_8514 Copy
Species: Mus musculus
Genetic Insert: CA-RIT-NFAT1
Vector Backbone Description: Backbone Marker:Anjana Rao lab; Vector Backbone:pRV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25680272
Comments: RIT mutations (R468, I469, and T535) selectively interfere with NFAT:AP-1 interaction
Proper citation: RRID:Addgene_85181 Copy
Species: Mus musculus
Genetic Insert: mouse NFH
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4344; Vector Backbone:pEGFP-C1 with EGFP sequence removed; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19468066
Comments: Please cite Çolakoğlu & Brown (2009), "Intermediate filaments exchange subunits along their length and elongate by end-to-end annealing", Journal of Cell Biology 185: 769-777. This plasmid was used in that study but was inadvertently not described in the Methods.
Proper citation: RRID:Addgene_85178 Copy
Species: Mus musculus
Genetic Insert: HOXB9
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:8657149
Proper citation: RRID:Addgene_8541 Copy
Species: Mus musculus
Genetic Insert: shCit-B
Vector Backbone Description: Backbone Size:6530; Vector Backbone:Banshee-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27795297
Proper citation: RRID:Addgene_85217 Copy
Species: Mus musculus
Genetic Insert: 5'UTR of IRF7
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26984228
Proper citation: RRID:Addgene_85490 Copy
Species: Mus musculus
Genetic Insert: HOXD4
Vector Backbone Description: Backbone Size:6400; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8600458
Comments: Popperl and Featherstone, EMBO J:11, 3673-80, 1992
Proper citation: RRID:Addgene_8549 Copy
Species: Mus musculus
Genetic Insert: HOXD4
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:8600458
Comments: Popperl and Featherstone, EMBO J:11, 3673-80, 1992
Proper citation: RRID:Addgene_8548 Copy
Species: Mus musculus
Genetic Insert: HOXD12
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pRSETa; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9343407
Comments: Fusion tags can be removed using enterokinase
Proper citation: RRID:Addgene_8554 Copy
Species: Mus musculus
Genetic Insert: shRNA targeting 3'UTR of Map3k2
Vector Backbone Description: Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24847881
Proper citation: RRID:Addgene_85657 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
