Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCRII-Topo Grp Resource Report Resource Website |
RRID:Addgene_45871 | GRP in situ probe | Mus musculus | Ampicillin | For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | nt 66-504 on NM_175012 | 2026-08-15 01:15:27 | 0 | |
|
pCRII-Topo Inhba Resource Report Resource Website |
RRID:Addgene_45868 | Inhba in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Inhba fragment was amplified by RT-PCR using the following primer pair: GCGATCAGAAAGCTTCATGTG AGACTGGCACCACTCTCCTG For in vitro transcription, use the Spe1 restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | nt 428-933 from Inhba mRNA (NM_008380.1) | 2026-08-15 01:15:27 | 0 |
|
pEGFP eIF2beta C-term (aa 89-331) Resource Report Resource Website |
RRID:Addgene_45901 | eIF2S2 aa89-331 | Mus musculus | Kanamycin | PMID:11959995 | PCR amplified using EcoRI/BamHI containing primers. G321D mutation is also present. | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | aa 89-331 | 2026-08-15 01:15:27 | 0 |
|
GST eIF2beta Resource Report Resource Website |
RRID:Addgene_45900 | eIF2S2 | Mus musculus | Ampicillin | PMID:11959995 | Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 0 | ||
|
pCRII-Topo Tmtc4 Resource Report Resource Website |
RRID:Addgene_45869 | TMTC4 in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Tmtc4 fragment was amplified by RT-PCR using the following primer pair: GAAGCAGAGCAGAGCTACCG TCTGAACAGAGGCTTCATGC For in vitro transcription, use the Spe1 restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | nt 1220-1798 on BC031368 | 2026-08-15 01:15:27 | 0 |
|
Tet-O-FUW-Zfp536 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45845 | Zfp536 | Mus musculus | Ampicillin | PMID:23584610 | Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 1 | ||
|
pLPCX-VEcadTS Resource Report Resource Website 1+ mentions |
RRID:Addgene_45848 | VE-cadherin Tension Sensor | Mus musculus | Ampicillin | PMID:23684974 | Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 3 | ||
|
pLPCX-VEcadTL Resource Report Resource Website 1+ mentions |
RRID:Addgene_45849 | VE-cadherin | Mus musculus | Ampicillin | PMID:23684974 | Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 2 | ||
|
Tet-O-FUW-Olig2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45844 | Olig2 | Mus musculus | Ampicillin | PMID:23584610 | Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 1 | ||
|
Tet-O-FUW-Sox10 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45843 | Sox10 | Mus musculus | Ampicillin | PMID:23584610 | Backbone Size:8377; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 3 | ||
|
pMSCV-puro-Delta-ATG1-mMCL1 Resource Report Resource Website |
RRID:Addgene_45823 | Delta ATG1-mMCL1 | Mus musculus | Ampicillin | PMID:22544066 | Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | The first amino acid (ATG) is deleted from the full length mouse MCL-1 | 2026-08-15 01:15:26 | 0 | |
|
pMSCV-puro-mMCL1 Delta C22 Resource Report Resource Website |
RRID:Addgene_45820 | mMCL-1 Delta C22 | Mus musculus | Ampicillin | PMID:22544066 | Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C-terminal 22 amino acids are deleted from full length mMCL-1 | 2026-08-15 01:15:26 | 0 | |
|
pBabe HA-Runx1-neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_45815 | Runx1 | Mus musculus | Ampicillin | PMID:21873240 | pBabe HA-Runx1 neo was constructed by PCR using a mouse Runx1 template (Open Biosystems) and the following primers: GCGCAGATCTATGTACCCATACGACGTCCCAGACTACGCTGCTTCAGACAGCATTTTTGAGTC (forward), GCGCGAATTCTCAGAAGCATTCACAGTTTCC (reverse). The PCR product was gel purified, digested with BglII and EcoRI, and then ligated into pBabe neo, which had been digested with BamHI and EcoRI and then dephosphorylated. | Backbone Marker:Weinberg Lab (Addgene plasmid 1767); Backbone Size:5300; Vector Backbone:pBabe neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 1 | |
|
pMSCV-puro-Delta N67-mMCL1 Resource Report Resource Website |
RRID:Addgene_45819 | Delta N67-mMCL-1 | Mus musculus | Ampicillin | PMID:22544066 | Note that AA68 has been changed from Pro to Met for start codon. | Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N-terminus 67 amino acids deleted from full length mMCL-1 | 2026-08-15 01:15:26 | 0 |
|
pSV HA eIF2beta (Pro110-113) Resource Report Resource Website |
RRID:Addgene_45899 | eIF2beta | Mus musculus | Bleocin (Zeocin) | PMID:11959995 | Two fragments were PCR amplified from GST-eIF2beta (Addgene plasmid 45900) and ligated together with vector to incorporate deletion. Xba1 site is used to ligate the 2 parts of eIF2beta. | Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:pZeoSV2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | P110A, P113A | 2026-08-15 01:15:27 | 0 |
|
pMRXIP GFP-VAMP7 Resource Report Resource Website |
RRID:Addgene_45920 | vesicle-associated membrane protein 7 | Mus musculus | Ampicillin | PMID:23217709 | Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6600; Vector Backbone:pMRXIP GFP-Ci2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 0 | ||
|
pNMHCII-C1-GFP Resource Report Resource Website |
RRID:Addgene_46041 | nonmuscle myosin heavy chain II-C, isoform C1 | Mus musculus | Kanamycin | PMID:16790446 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:28 | 0 | ||
|
pNMHCII-C1C2-GFP Resource Report Resource Website |
RRID:Addgene_46044 | nonmuscle myosin heavy chain II-C, isoform C1C2 | Mus musculus | Kanamycin | PMID:19240025 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:28 | 0 | ||
|
tetO-Hand2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46028 | Hand2 | Mus musculus | Ampicillin | PMID:23591016 | Vector Backbone:tetO-Gateway; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:28 | 1 | ||
|
pUAST YFP mouse Rab35 DN Resource Report Resource Website |
RRID:Addgene_46016 | Rab35 | Mus musculus | Ampicillin | PMID:19729655 | Backbone Size:8900; Vector Backbone:pUAST; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin | S22N (dominant negative) | 2026-08-15 01:15:28 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
