Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Arabidopsis thaliana
Genetic Insert: GAI
Vector Backbone Description: Vector Backbone:Lyn-CFP-FRB; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22446836
Comments: Lyn-CFP-FRB was created by inserting Lyn into the pEGFP- C1 vector (Clontech) whose EGFP is replaced with CFP-FRB.
Proper citation: RRID:Addgene_37311 Copy
Species: Drosophila melanogaster
Genetic Insert: SOCS36E enhancer fragment
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression, Luciferase, JAK/STAT reporter construct; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16055650
Comments: Perrimon Lab plasmid #446
A 441-bp genomic fragment in the enhancer of SOCS36E containing two potential STAT92E-binding sites was amplified by PCR, using five different sets of oligos: (1) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (2) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), CTGCAGATACAAAACTGTCTTAGGTGTTTA (PstI); (3) GAATTCGAACCACTCAGAGTGCCTGCGTGT (EcoRI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (4) AGATCTGAACCACTCAGAGTGCCTGCGTGT (BglII), AGATCTATACAAAACTGTCTTAGGTGTTTA (BglII); (5) GCGGCCGCGAACCACTCAGAGTGCCTGCGTGT (NotI), GCGGCCGCATACAAAACTGTCTTAGGTGTTTA (NotI).
Each amplified genomic fragment containing different restriction enzyme sites was sequentially subcloned into pUAST. The genomic fragment amplified using the first set of oligos was subcloned into the PstI/EcoRI sites of pUAST to generate 2XSTAT92E. The genomic fragment amplified using the second set of oligos was subcloned into the PstI site of 2XSTAT92E to generate 4XSTAT92E. The genomic fragment amplified using the third set of oligos was subcloned into the EcoRI site of 4XSTAT92E to generate 6XSTAT92E. The genomic fragment amplified using the fourth set of oligos was subcloned into the BglII site of 6XSTAT92E to generate 8XSTAT92E.
Next, the hsp70 minimal promoter element was amplified from pUAST by PCR using oligos GCGGCCGCAGCGGAGACTCTAGCGAGCG (NotI) and CTCGAGAATTCCCTATTCAGAGTTCT (XhoI). This
hsp70 minimal promoter was subcloned into the NotI/XhoI sites of 8XSTAT92E to generate 8XSTAT92E–hsp70. Again, the genomic fragment amplified using the fifth set of oligos was subcloned into the NotI site of 8XSTAT92E–hsp70 vector to generate 10XSTAT92E–hsp70.
Finally, an XhoI/XbaI fragment containing the firefly luciferase gene from the pGL3–luciferase vector (Promega) was subcloned into the XhoI/XbaI sites of 10XSTAT92E–hsp70 to generate 10XSTAT92E–luciferase.
Proper citation: RRID:Addgene_37393 Copy
Species: Homo sapiens
Genetic Insert: Dynactin 2
Vector Backbone Description: Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22327364
Comments: Please note that Addgene's sequencing results identified single nucleotide mismatches at bp# 2273 & 2347 when compared to the full plasmid sequence provided by the depositing laboratory. The mismatch at bp#2273 causes A7P mutation in the DCTN2 seqeuence.
Proper citation: RRID:Addgene_37388 Copy
Species: Drosophila melanogaster
Genetic Insert: porcupine
Vector Backbone Description: Backbone Size:7855; Vector Backbone:pCaSpeR-4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8985181
Comments: Perrimon Lab plasmid #123
The EcoRI-XbaI genomic DNA covering the porc locus was cloned in pCaspeR4 to generate a genomic porc rescue construct.
Proper citation: RRID:Addgene_37376 Copy
Species: Homo sapiens
Genetic Insert: HsNot1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4755; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21981923
Proper citation: RRID:Addgene_37370 Copy
Species: Drosophila melanogaster
Genetic Insert: PolIII-Renilla control reporter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3320; Vector Backbone:pRL-null; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16311596
Comments: Perrimon Lab plasmid #414
The PolIII–Renilla luciferase control construct was generated by PCR amplification of a fragment (base pairs 43,224–43,389 of scaffold AE003823) of the promoter of the D. melanogaster RNA PolIII 128 subunit (RpIII128) with a 5' BglII and a 3' SpeI site and ligation of this fragment into the BglII and SpeI sites of pRL-null.
Proper citation: RRID:Addgene_37380 Copy
Genetic Insert: Cre Shine
Vector Backbone Description: Backbone Marker:Invitrogene; Backbone Size:5060; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_37404 Copy
Species: Homo sapiens
Genetic Insert: Plk1
Vector Backbone Description: Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22327364
Proper citation: RRID:Addgene_37406 Copy
Species: Homo sapiens
Genetic Insert: npc1l1
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5000; Vector Backbone:pFASTBAC; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21525977
Comments: There is a TEV cleavage site downstream of His tag.
Proper citation: RRID:Addgene_37366 Copy
Species: Synthetic
Genetic Insert: NLS-mCherry
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21397594
Proper citation: RRID:Addgene_37354 Copy
Species: Synthetic
Genetic Insert: membrane TdTomato
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21397594
Comments: *palmitoylation sequence: 5'-atgctgtgctgtatgagaagaaccaaacaggttgaaaagaatgatgaggaccaaaagatc-3'
Proper citation: RRID:Addgene_37351 Copy
Species: Pea
Genetic Insert: Connexin43 fused to pea APEX
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23086203
Proper citation: RRID:Addgene_44439 Copy
Vector Backbone Description: Backbone Size:4850; Vector Backbone:pBabe; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15644491
Proper citation: RRID:Addgene_44433 Copy
Species: Vibrio cholerae
Genetic Insert: AphA
Vector Backbone Description: Backbone Marker:AATC; Backbone Size:8807; Vector Backbone:pMMB66EH; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23919997
Proper citation: RRID:Addgene_44392 Copy
Species: Homo sapiens
Genetic Insert: mitoDsRed
Vector Backbone Description: Backbone Size:6727; Vector Backbone:pLV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23314018
Comments: Limitations of allotopic expression of mitochondrial genes in mammalian cells. Oca-Cossio J, Kenyon L, Hao H, Moraes CT.
Genetics. 2003 Oct;165(2):707-20. PMID: 14573482
Proper citation: RRID:Addgene_44386 Copy
Species: Homo sapiens
Genetic Insert: mitoGFP
Vector Backbone Description: Backbone Size:6727; Vector Backbone:pLV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23314018
Proper citation: RRID:Addgene_44385 Copy
Species: Drosophila melanogaster
Genetic Insert: Minimal Mos1, NeoR, peel-1, MCS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2305; Vector Backbone:pDESTR4-R3; Vector Types:Multiple cloning site vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24820376
Proper citation: RRID:Addgene_44484 Copy
Species: Drosophila melanogaster
Genetic Insert: Minimal Mos1 [Peft-3 GFP H2B tbb-2 UTR, NeoR]
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2445; Vector Backbone:pDESTR4-R3; Vector Types:Gateway expression clone; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24820376
Proper citation: RRID:Addgene_44489 Copy
Species: Drosophila melanogaster
Genetic Insert: 500bp Mos1, unc-119, fosmid cassette
Vector Backbone Description: Backbone Size:1682; Vector Backbone:Unknown; Vector Types:Fosmid recombineering cassette; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24820376
Proper citation: RRID:Addgene_44488 Copy
Species: Drosophila melanogaster
Genetic Insert: Minimal Mos1, NeoR, MCS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2305; Vector Backbone:pDESTR4-R3; Vector Types:Multiple cloning site vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24820376
Proper citation: RRID:Addgene_44481 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
