Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-TIMM22-right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTTGCATCAATGCCGG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_47298 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-tbx4-right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGGGCAACGGTCATTCCT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_47290 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-tetmethylcytosinedioxygenase1(previous-left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCAACTCGCGCATCCACA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_47291 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-stxbp1a-left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCAGCTTGCCCTGACCCC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_47281 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-stxbp1a-right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGGAGGCACGGCTCTTCA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_47282 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-SYNE2-right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCGCCCTCTAACTCAGCT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_47288 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-swap70b-right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCCAGGGCTGTGAAGG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_47286 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-snai1b-right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCTTGACAAGAAATGAGC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_47272 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-spermassociatedantigen7-left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTCTGGGCTCGATCTTGA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_47273 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-smyd1a-right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCTCTGGTACCCCGCAGA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_47270 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-spermassociatedantigen7-right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGATCGTGAACGGTTGGA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_47274 Copy
Species: Danio rerio
Genetic Insert: friend leukemia integration 1b
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:2515; Vector Backbone:pdonr221; Vector Types:gateway middle entry; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24036310
Proper citation: RRID:Addgene_49019 Copy
Species: Danio rerio
Genetic Insert: Etv5 S142 D
Vector Backbone Description: Backbone Marker:RZPD; Backbone Size:4095; Vector Backbone:pCs2+; Vector Types:Mammalian Expression, xenopus/avian/zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20346941
Proper citation: RRID:Addgene_49096 Copy
Species: Danio rerio
Genetic Insert: Alpha A-crystallin
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3716; Vector Backbone:pET-20b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22479631
Proper citation: RRID:Addgene_47664 Copy
Species: Danio rerio
Genetic Insert: Alpha A-crystallin
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3716; Vector Backbone:pET-20b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22479631
Proper citation: RRID:Addgene_47628 Copy
Species: Danio rerio
Genetic Insert: Alpha Ba-crystallin
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3716; Vector Backbone:pET-20b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22479631
Proper citation: RRID:Addgene_47620 Copy
Species: Danio rerio
Genetic Insert: Alpha A-crystallin
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3716; Vector Backbone:pET-20b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22479631
Proper citation: RRID:Addgene_47619 Copy
Species: Danio rerio
Genetic Insert: golden gRNA
Vector Backbone Description: Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918387
Comments: For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/
gRNA target sequence GGTCTCTCGCAGGATGTTGC
Proper citation: RRID:Addgene_47930 Copy
Species: Danio rerio
Genetic Insert: mitfa gRNA
Vector Backbone Description: Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918387
Comments: For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/
gRNA target sequence GGTCTCTCGCAGGATGTTGC
Proper citation: RRID:Addgene_47931 Copy
Species: Danio rerio
Genetic Insert: ddx19 gRNA
Vector Backbone Description: Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918387
Comments: For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/
gRNA target sequence GGCAACAGATTCGTGGGCCC
Proper citation: RRID:Addgene_47932 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
