Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 17 showing 321 ~ 340 out of 164,533 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_176496

http://www.addgene.org/176496

Genetic Insert: puroR-T2A-TetOn3G
Vector Backbone Description: Vector Backbone:pCamR; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29507340
Comments: Addgene QC identified a P93S difference in the PuroR selectable marker that the depositing lab does not believe to affect function.

Proper citation: RRID:Addgene_176496 Copy   


  • RRID:Addgene_176499

http://www.addgene.org/176499

Species: Homo sapiens
Genetic Insert: EGFP-T2A-TFEB(human; full-length; S3E mutation)-
Vector Backbone Description: Vector Backbone:pCamR; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29507340

Proper citation: RRID:Addgene_176499 Copy   


  • RRID:Addgene_176405

http://www.addgene.org/176405

Species: Saccharomyces cerevisiae
Genetic Insert: Mitochondrial FAD-linked sulfhydryl oxidase
Vector Backbone Description: Backbone Size:5068; Vector Backbone:pACYC184-TU2A-RFP; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.31.458447v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_176405 Copy   


  • RRID:Addgene_176404

http://www.addgene.org/176404

Species: Other
Genetic Insert: FAD-linked sulfhydryl oxidase ERV2 from Fol
Vector Backbone Description: Backbone Size:5068; Vector Backbone:pACYC184-TU2A-RFP; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.31.458447v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_176404 Copy   


  • RRID:Addgene_176583

    This resource has 1+ mentions.

http://www.addgene.org/176583

Genetic Insert: pRARE2 plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc

Proper citation: RRID:Addgene_176583 Copy   


  • RRID:Addgene_176582

http://www.addgene.org/176582

Genetic Insert: pRARE2 plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag

Proper citation: RRID:Addgene_176582 Copy   


  • RRID:Addgene_176734

http://www.addgene.org/176734

Species: Candida albicans
Genetic Insert: bar1Ca
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.

Proper citation: RRID:Addgene_176734 Copy   


  • RRID:Addgene_176737

http://www.addgene.org/176737

Species: Kazachstania naganishii
Genetic Insert: bar1Kn
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.

Proper citation: RRID:Addgene_176737 Copy   


  • RRID:Addgene_176736

http://www.addgene.org/176736

Species: Kluyveromyces lactis
Genetic Insert: bar1Kl
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.

Proper citation: RRID:Addgene_176736 Copy   


  • RRID:Addgene_176731

http://www.addgene.org/176731

Species: Saccharomyces cerevisiae
Genetic Insert: ste2Sc
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.

Proper citation: RRID:Addgene_176731 Copy   


  • RRID:Addgene_176730

http://www.addgene.org/176730

Species: Lachancea thermotolerans
Genetic Insert: ste2Lt
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.

Proper citation: RRID:Addgene_176730 Copy   


  • RRID:Addgene_176723

http://www.addgene.org/176723

Species: Candida albicans
Genetic Insert: ste2Ca
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.

Proper citation: RRID:Addgene_176723 Copy   


  • RRID:Addgene_176726

http://www.addgene.org/176726

Species: Kluyveromyces lactis
Genetic Insert: ste2Kl
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.

Proper citation: RRID:Addgene_176726 Copy   


  • RRID:Addgene_176728

http://www.addgene.org/176728

Species: Lachancea fermentati
Genetic Insert: ste2Lf
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.

Proper citation: RRID:Addgene_176728 Copy   


  • RRID:Addgene_176722

http://www.addgene.org/176722

Species: Vanderwaltozyma polyspora
Genetic Insert: mfalpha1Vp
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.

Proper citation: RRID:Addgene_176722 Copy   


  • RRID:Addgene_176713

http://www.addgene.org/176713

Species: Eremothecium cymbalariae
Genetic Insert: mfalpha1Ec
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.

Proper citation: RRID:Addgene_176713 Copy   


  • RRID:Addgene_176715

http://www.addgene.org/176715

Species: Kluyveromyces lactis
Genetic Insert: mfalpha1Kl
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.

Proper citation: RRID:Addgene_176715 Copy   


  • RRID:Addgene_176717

http://www.addgene.org/176717

Species: Lachancea fermentati
Genetic Insert: mfalpha1Lf
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.

Proper citation: RRID:Addgene_176717 Copy   


  • RRID:Addgene_176716

http://www.addgene.org/176716

Species: Kazachstania naganishii
Genetic Insert: mfalpha1Kn
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.

Proper citation: RRID:Addgene_176716 Copy   


  • RRID:Addgene_176719

http://www.addgene.org/176719

Species: Lachancea thermotolerans
Genetic Insert: mfalpha1Lt
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.

Proper citation: RRID:Addgene_176719 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X