Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pcDNAI-GAL4-CREB-S133A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46770 GAL4(1-147)-CREB-S133A Rattus norvegicus Ampicillin PMID:7958915 Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNAI-AMP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Changed CREB serine 133 to Alanine 2026-08-15 01:15:35 1
pcDNAI-GAL4-CREB
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46769 GAL4(1-147)-CREB Rattus norvegicus Ampicillin PMID:7958915 Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNAI-AMP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 1
pKIKOarsBCm
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46763 Chloramphenicol and Ampicillin PMID:23799955 This plasmid is used for integration of DNA into the E.coli genome via homologous recombination. The DNA of interest is cloned between arsB homologous arms and integrated at the arsB locus. This plasmid has been found exist in our stock as a multimer. Plasmid multimerization often does not impact plasmid function, but may reduce transformation efficiencies. You may need to screen multiple colonies to isolate the monomeric version of this plasmid. If you still have trouble isolating the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid. Backbone Size:3267; Vector Backbone:pKD4; Vector Types:E.coli genomic integration; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:15:35 1
pKIKOlacZCm
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46764 Chloramphenicol and Ampicillin PMID:23799955 This plasmid is used for integration of DNA into the E.coli genome via homologous recombination. The DNA of interest is cloned between lacZ homologous arms and integrated at the lacZ locus. Backbone Size:3267; Vector Backbone:pKD4; Vector Types:E.coli genomic integration; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:15:35 1
pKIKOlacZKm
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46767 Ampicillin and Kanamycin PMID:23799955 This plasmid is used for integration of DNA into the E.coli genome via homologous recombination. The DNA of interest is cloned between lacZ homologous arms and integrated at the lacZ locus. Backbone Size:3267; Vector Backbone:pKD4; Vector Types:E.coli genomic integration; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:15:35 1
pKIKOarsBKm
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46766 Ampicillin and Kanamycin PMID:23799955 This plasmid is used for integration of DNA into the E.coli genome via homologous recombination. The DNA of interest is cloned between arsB homologous arms and integrated at the arsB locus. Backbone Size:3267; Vector Backbone:pKD4; Vector Types:E.coli genomic integration; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:15:35 5
pT7-gRNA
 
Resource Report
Resource Website
50+ mentions 		RRID:Addgene_46759 gRNA core Synthetic Ampicillin PMID:23918387 For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ Backbone Size:2400; Vector Backbone:pUC19; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 68
pQHA-USP7 WT puroR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46753 USP7 Homo sapiens Ampicillin PMID:20601937 Sequence discrepancies between the full and QC sequences have no functional consequence. Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 5
pQHA-USP11 CS puroR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46750 USP11 Homo sapiens Ampicillin PMID:20601937 Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin C318S--catalytically inactive 2026-08-15 01:15:35 3
pQFlag-USP7 WT puroR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46751 USP7 Homo sapiens Ampicillin PMID:20601937 Sequence discrepancies between the full and QC sequences have no functional consequence. Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 4
pT3TS-nCas9n
 
Resource Report
Resource Website
100+ mentions 		RRID:Addgene_46757 Cas9 Synthetic Ampicillin PMID:23918387 For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ Backbone Size:2800; Vector Backbone:pT3T7; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 131
pQHA-USP7 CS puroR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46754 USP7 Homo sapiens Ampicillin PMID:20601937 Sequence discrepancies between the full and QC sequences have no functional consequence. Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin C223S--catalytically inactive 2026-08-15 01:15:35 2
pQFlag-USP11 WT puroR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46747 USP11 Ampicillin PMID:20601937 Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 1
pQFlag-USP11 CS puroR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46748 USP11 Homo sapiens Ampicillin PMID:20601937 Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin C318S--catalytically inactive 2026-08-15 01:15:35 1
pBABE-Puro-KRas*G12V
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_46746 KRAS*G12V Homo sapiens Ampicillin PMID:23246410 Backbone Size:5169; Vector Backbone:pBABE-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin carries the oncogenic G12V mutation and cDNA is encoded by a chimeric mixture of HRAS and KRAS codons that encode KRas protein 2026-08-15 01:15:35 14
pMX-Brn4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47028 Brn4 Mus musculus Ampicillin PMID:22445517 Backbone Size:5871; Vector Backbone:pMX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin The insert includes 40 bp of the TOPO vector in the 5 end 2026-08-15 01:15:37 1
pCDH-puro-Bcl2
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_46971 Bcl2 Homo sapiens Ampicillin PMID:23403638 Bcl-2 was cut from 3544 pMIG Bcl-2 (Addgene #8793) and subcloned into the EcoRI sites of pCDH-CMV-MCS-EF1-Puro. Backbone Marker:System Biosciences; Vector Backbone:PCDH-CMV-MCS-EF1-PURO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 10
pMusheLL
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47023 Mu L1+L2 Mus musculus Ampicillin PMID:22985477 Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 1
pICE-EGFP-FLAG-Ku70siR-WT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46961 human Ku70 Homo sapiens Ampicillin PMID:23897892 Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 1
pICH86966::AtU6p::sgRNA_PDS
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_46966 AtU6p::sgRNA_PDS Synthetic Kanamycin PMID:23929340 gRNA target sequence GCCGTTAATTTGAGAGTCCA Backbone Size:6340; Vector Backbone:pICH86966; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:37 25

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch