Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:danio rerio (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

2,192 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
TAL3579
 
Resource Report
Resource Website 		RRID:Addgene_47298 ZebrafishCommunity-TIMM22-right Danio rerio Ampicillin PMID:21822241 Target binding site: TTTGCATCAATGCCGG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:15:40 0
TAL3571
 
Resource Report
Resource Website 		RRID:Addgene_47290 ZebrafishCommunity-tbx4-right Danio rerio Ampicillin PMID:21822241 Target binding site: TGGGCAACGGTCATTCCT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:15:40 0
TAL3572
 
Resource Report
Resource Website 		RRID:Addgene_47291 ZebrafishCommunity-tetmethylcytosinedioxygenase1(previous-left Danio rerio Ampicillin PMID:21822241 Target binding site: TCAACTCGCGCATCCACA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:15:41 0
TAL3562
 
Resource Report
Resource Website 		RRID:Addgene_47281 ZebrafishCommunity-stxbp1a-left Danio rerio Ampicillin PMID:21822241 Target binding site: TCAGCTTGCCCTGACCCC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:15:40 0
TAL3563
 
Resource Report
Resource Website 		RRID:Addgene_47282 ZebrafishCommunity-stxbp1a-right Danio rerio Ampicillin PMID:21822241 Target binding site: TGGAGGCACGGCTCTTCA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:15:41 0
TAL3569
 
Resource Report
Resource Website 		RRID:Addgene_47288 ZebrafishCommunity-SYNE2-right Danio rerio Ampicillin PMID:21822241 Target binding site: TCGCCCTCTAACTCAGCT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:15:41 0
TAL3567
 
Resource Report
Resource Website 		RRID:Addgene_47286 ZebrafishCommunity-swap70b-right Danio rerio Ampicillin PMID:21822241 Target binding site: TCCAGGGCTGTGAAGG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:15:40 0
TAL3553
 
Resource Report
Resource Website 		RRID:Addgene_47272 ZebrafishCommunity-snai1b-right Danio rerio Ampicillin PMID:21822241 Target binding site: TCTTGACAAGAAATGAGC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:15:39 0
TAL3554
 
Resource Report
Resource Website 		RRID:Addgene_47273 ZebrafishCommunity-spermassociatedantigen7-left Danio rerio Ampicillin PMID:21822241 Target binding site: TTCTGGGCTCGATCTTGA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:15:40 0
TAL3551
 
Resource Report
Resource Website 		RRID:Addgene_47270 ZebrafishCommunity-smyd1a-right Danio rerio Ampicillin PMID:21822241 Target binding site: TCTCTGGTACCCCGCAGA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:15:40 0
TAL3555
 
Resource Report
Resource Website 		RRID:Addgene_47274 ZebrafishCommunity-spermassociatedantigen7-right Danio rerio Ampicillin PMID:21822241 Target binding site: TGATCGTGAACGGTTGGA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:15:39 0
pME-fli1b
 
Resource Report
Resource Website 		RRID:Addgene_49019 friend leukemia integration 1b Danio rerio Kanamycin PMID:24036310 Backbone Marker:invitrogen; Backbone Size:2515; Vector Backbone:pdonr221; Vector Types:gateway middle entry; Bacterial Resistance:Kanamycin 2026-08-15 01:15:56 0
Cs2+Etv5 S142D
 
Resource Report
Resource Website 		RRID:Addgene_49096 Etv5 S142 D Danio rerio Ampicillin PMID:20346941 Backbone Marker:RZPD; Backbone Size:4095; Vector Backbone:pCs2+; Vector Types:Mammalian Expression, xenopus/avian/zebrafish; Bacterial Resistance:Ampicillin S142D 2026-08-15 01:15:57 0
Cyprinodon variegatus cryaa
 
Resource Report
Resource Website 		RRID:Addgene_47664 Alpha A-crystallin Danio rerio Ampicillin PMID:22479631 Backbone Marker:Novagen; Backbone Size:3716; Vector Backbone:pET-20b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:44 0
Danio rerio cryaa T147V
 
Resource Report
Resource Website 		RRID:Addgene_47628 Alpha A-crystallin Danio rerio Ampicillin PMID:22479631 Backbone Marker:Novagen; Backbone Size:3716; Vector Backbone:pET-20b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Changed Theronine 147 to Valine 2026-08-15 01:15:43 0
Danio rerio cryaba
 
Resource Report
Resource Website 		RRID:Addgene_47620 Alpha Ba-crystallin Danio rerio Ampicillin PMID:22479631 Backbone Marker:Novagen; Backbone Size:3716; Vector Backbone:pET-20b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:43 0
Danio rerio cryaa C143S
 
Resource Report
Resource Website 		RRID:Addgene_47619 Alpha A-crystallin Danio rerio Ampicillin PMID:22479631 Backbone Marker:Novagen; Backbone Size:3716; Vector Backbone:pET-20b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Cysteine 143 to Serine 2026-08-15 01:15:42 0
pT7goldRNA
 
Resource Report
Resource Website 		RRID:Addgene_47930 golden gRNA Danio rerio Ampicillin PMID:23918387 For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ gRNA target sequence GGTCTCTCGCAGGATGTTGC Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 0
pT7mitfagRNA
 
Resource Report
Resource Website 		RRID:Addgene_47931 mitfa gRNA Danio rerio Ampicillin PMID:23918387 For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ gRNA target sequence GGTCTCTCGCAGGATGTTGC Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:47 0
pT7ddx19gRNA
 
Resource Report
Resource Website 		RRID:Addgene_47932 ddx19 gRNA Danio rerio Ampicillin PMID:23918387 For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ gRNA target sequence GGCAACAGATTCGTGGGCCC Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch