Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pSGE_881_Nhe2_EcR-to-HLH4C Resource Report Resource Website |
RRID:Addgene_71186 | 881_Nhe2_EcR-to-HLH4C | Synthetic | Ampicillin | PMID:26550828 | Vector Backbone:unknown; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:09 | 0 | ||
|
pSGE_MC19_Trl-2xUAS_dCP Resource Report Resource Website |
RRID:Addgene_71170 | MC19_Trl-2xUAS_dCP | Synthetic | Ampicillin | PMID:26550828 | Vector Backbone:unknown; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:09 | 0 | ||
|
pSGE_717_S2-1_CGCG-to-DFD Resource Report Resource Website |
RRID:Addgene_71174 | 717_S2-1_CGCG-to-DFD | Synthetic | Ampicillin | PMID:26550828 | Vector Backbone:unknown; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:09 | 0 | ||
|
pSGE_719_S2-1_GATA-to-ETS21C Resource Report Resource Website |
RRID:Addgene_71175 | 719_S2-1_GATA-to-ETS21C | Synthetic | Ampicillin | PMID:26550828 | Vector Backbone:unknown; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:09 | 0 | ||
|
pCCL-PGK-SPdCas9-BFP-DNMT3A(E752A) Resource Report Resource Website |
RRID:Addgene_71213 | dSpCas9-BFP-DNMT3A(E752A), DNMT3A catalytic domain with inactivation mutation E752A | Synthetic | Ampicillin | PMID:29635374 | Vector Backbone:3rd Generation lentiviral vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:09 | 0 | ||
|
pSGE_975_Nhe2_EcR-mut Resource Report Resource Website |
RRID:Addgene_71179 | 975_Nhe2_EcR-mut | Synthetic | Ampicillin | PMID:26550828 | Vector Backbone:unknown; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:09 | 0 | ||
|
pLenti-EF1a-SPdCas9-DNMT3B-2A-Blast Resource Report Resource Website 1+ mentions |
RRID:Addgene_71217 | dSpCas9-DNMT3B catalytic domain | Synthetic | Ampicillin | PMID:29635374 | Vector Backbone:3rd generation lentiviral vector; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:09 | 1 | ||
|
pRB1080 Resource Report Resource Website |
RRID:Addgene_71309 | VQR Cas9 variant | Synthetic | Ampicillin | PMID:26680661 | Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 | Vector Backbone:pCFJ601; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:10 | 0 | |
|
pME-2PH-PLCd Resource Report Resource Website |
RRID:Addgene_71283 | 2PH-PLC delta (Human) | Synthetic | Kanamycin | PMID:26585296 | Backbone Marker:Invitrogen; Vector Backbone:pDONR 221; Vector Types:Gateway multisite middle entry clone; Bacterial Resistance:Kanamycin | 2026-08-15 01:19:10 | 0 | ||
|
pHEE401E Resource Report Resource Website 1+ mentions |
RRID:Addgene_71287 | gRNA scaffold | Synthetic | Kanamycin | PMID:26193878 | Please see the cloning protocol attachments for detailed descriptions on how to insert sgRNA sequences into this plasmid. | Vector Backbone:pCambia; Vector Types:Plant Expression, CRISPR, Plant binary vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:19:10 | 6 | |
|
pHEE2E-TRI Resource Report Resource Website 1+ mentions |
RRID:Addgene_71288 | sgRNA targeting TRY and CPC genes | Synthetic | Kanamycin | PMID:26193878 | TRY & CPC sgRNA target sequence is: AATATCTCTCTATCTCCTC ETC2 sgRNA target sequence is: GAAGTGAGTAGCATCGAAT See Figure 1B of the associated publication for more details. | Vector Backbone:pCambia; Vector Types:Plant Expression, CRISPR, Plant binary vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:19:10 | 4 | |
|
pSMART-Ala2 Resource Report Resource Website |
RRID:Addgene_71326 | NADPH Alanine Dehydrogenase | Synthetic | Kanamycin | PMID:34600151 | Read the preprint at bioRxiv: https://www.biorxiv.org/content/10.1101/2020.08.30.274290v1.full. | Backbone Marker:Lucigen (Middleton, WI); Backbone Size:1800; Vector Backbone:pSMART-HCKan (AF532107.1); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | D196A, L197R | 2026-08-15 01:19:10 | 0 |
|
Mito-Cyan Nano-lantern(Ca2+)/pcDNA3 Resource Report Resource Website |
RRID:Addgene_71345 | hOTC_Cyan Nano-lantern(Ca2+) | Synthetic | Ampicillin | PMID:25831507 | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:10 | 0 | ||
|
Cyan Nano-lantern(Ca2+)/pcDNA3 Resource Report Resource Website |
RRID:Addgene_71344 | Cyan Nano-lantern(Ca2+) | Synthetic | Ampicillin | PMID:25831507 | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:10 | 0 | ||
|
Nuc-Orange Nano-lantern(Ca2+)/pcDNA3 Resource Report Resource Website |
RRID:Addgene_71349 | Orange Nano-lantern(Ca2+)_H2B | Synthetic | Ampicillin | PMID:25831507 | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:10 | 0 | ||
|
AgAK Resource Report Resource Website |
RRID:Addgene_71290 | Adenosine Kinase | Synthetic | Ampicillin | PMID:21247194 | Backbone Marker:Invitrogen; Vector Backbone:pDEST14; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:10 | 0 | ||
|
pPRIME-dsRed-shscramble Resource Report Resource Website |
RRID:Addgene_71384 | CMV promoter-dsRed-mir30-shscramble | Synthetic | Ampicillin | PMID:26094607 | this plasmid is modified from the pRIME system. See: Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102, 13212–13217 We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664) to make pPRIME-dsRed-scramble | Vector Backbone:pUC; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:11 | 0 | |
|
pAAV-UbC-eGFP-F Resource Report Resource Website 1+ mentions |
RRID:Addgene_71545 | eGFP-F | Synthetic | Ampicillin | Backbone Marker:Chung K-H et al., Polycistronic RNA polymerase II expression vectors for RNA interference based on BIC/miR-155. NAR 2006 vol 24 ; Backbone Size:5235; Vector Backbone:pAAV-SIBR-anti_I; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:12 | 1 | |||
|
pKM342 Resource Report Resource Website 1+ mentions |
RRID:Addgene_71486 | loxP-hyg-loxP cassette | Synthetic | Ampicillin | PMID:25779316 | The floxed hyg cassette is flanked by AscI sites, which can be recovered by restriction digestion for use in the construction of recombineering substrates, or amplified by PCR using the following targeting sequences: CGCTCTAGAACTAGTGGATCC ATGCCTGCAGGTCGACTC | Backbone Marker:Kenan Murphy; Backbone Size:2741; Vector Backbone:pKM328; Vector Types:Bacterial Expression, Source of loxP-hyg-loxP for PCR amplification.; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:11 | 2 | |
|
U_(+36GFP)-Cre.ape Resource Report Resource Website |
RRID:Addgene_71749 | U_(pos36GFP)-Cre | Synthetic | Ampicillin | PMID:26465072 | Backbone Marker:Novagen; Backbone Size:5181; Vector Backbone:pET29; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:13 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
