Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: 881_Nhe2_EcR-to-HLH4C
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26550828
Proper citation: RRID:Addgene_71186 Copy
Species: Synthetic
Genetic Insert: MC19_Trl-2xUAS_dCP
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26550828
Proper citation: RRID:Addgene_71170 Copy
Species: Synthetic
Genetic Insert: 717_S2-1_CGCG-to-DFD
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26550828
Proper citation: RRID:Addgene_71174 Copy
Species: Synthetic
Genetic Insert: 719_S2-1_GATA-to-ETS21C
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26550828
Proper citation: RRID:Addgene_71175 Copy
Species: Synthetic
Genetic Insert: dSpCas9-BFP-DNMT3A(E752A), DNMT3A catalytic domain with inactivation mutation E752A
Vector Backbone Description: Vector Backbone:3rd Generation lentiviral vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29635374
Proper citation: RRID:Addgene_71213 Copy
Species: Synthetic
Genetic Insert: 975_Nhe2_EcR-mut
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26550828
Proper citation: RRID:Addgene_71179 Copy
Species: Synthetic
Genetic Insert: dSpCas9-DNMT3B catalytic domain
Vector Backbone Description: Vector Backbone:3rd generation lentiviral vector; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29635374
Proper citation: RRID:Addgene_71217 Copy
Species: Synthetic
Genetic Insert: VQR Cas9 variant
Vector Backbone Description: Vector Backbone:pCFJ601; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26680661
Comments: Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_71309 Copy
Species: Synthetic
Genetic Insert: 2PH-PLC delta (Human)
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR 221; Vector Types:Gateway multisite middle entry clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26585296
Proper citation: RRID:Addgene_71283 Copy
Species: Synthetic
Genetic Insert: gRNA scaffold
Vector Backbone Description: Vector Backbone:pCambia; Vector Types:Plant Expression, CRISPR, Plant binary vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26193878
Comments: Please see the cloning protocol attachments for detailed descriptions on how to insert sgRNA sequences into this plasmid.
Proper citation: RRID:Addgene_71287 Copy
Species: Synthetic
Genetic Insert: sgRNA targeting TRY and CPC genes
Vector Backbone Description: Vector Backbone:pCambia; Vector Types:Plant Expression, CRISPR, Plant binary vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26193878
Comments: TRY & CPC sgRNA target sequence is: AATATCTCTCTATCTCCTC
ETC2 sgRNA target sequence is: GAAGTGAGTAGCATCGAAT
See Figure 1B of the associated publication for more details.
Proper citation: RRID:Addgene_71288 Copy
Species: Synthetic
Genetic Insert: NADPH Alanine Dehydrogenase
Vector Backbone Description: Backbone Marker:Lucigen (Middleton, WI); Backbone Size:1800; Vector Backbone:pSMART-HCKan (AF532107.1); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34600151
Comments: Read the preprint at bioRxiv: https://www.biorxiv.org/content/10.1101/2020.08.30.274290v1.full.
Proper citation: RRID:Addgene_71326 Copy
Species: Synthetic
Genetic Insert: hOTC_Cyan Nano-lantern(Ca2+)
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25831507
Proper citation: RRID:Addgene_71345 Copy
Species: Synthetic
Genetic Insert: Cyan Nano-lantern(Ca2+)
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25831507
Proper citation: RRID:Addgene_71344 Copy
Species: Synthetic
Genetic Insert: Orange Nano-lantern(Ca2+)_H2B
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25831507
Proper citation: RRID:Addgene_71349 Copy
Species: Synthetic
Genetic Insert: Adenosine Kinase
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDEST14; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21247194
Proper citation: RRID:Addgene_71290 Copy
Species: Synthetic
Genetic Insert: CMV promoter-dsRed-mir30-shscramble
Vector Backbone Description: Vector Backbone:pUC; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26094607
Comments: this plasmid is modified from the pRIME system. See:
Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A
lentiviral microRNA-based system for single-copy polymerase II-regulated
RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102,
13212–13217
We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664) to make pPRIME-dsRed-scramble
Proper citation: RRID:Addgene_71384 Copy
Species: Synthetic
Genetic Insert: eGFP-F
Vector Backbone Description: Backbone Marker:Chung K-H et al., Polycistronic RNA polymerase II expression vectors for RNA interference based on BIC/miR-155. NAR 2006 vol 24 ; Backbone Size:5235; Vector Backbone:pAAV-SIBR-anti_I; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_71545 Copy
Species: Synthetic
Genetic Insert: loxP-hyg-loxP cassette
Vector Backbone Description: Backbone Marker:Kenan Murphy; Backbone Size:2741; Vector Backbone:pKM328; Vector Types:Bacterial Expression, Source of loxP-hyg-loxP for PCR amplification.; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25779316
Comments: The floxed hyg cassette is flanked by AscI sites, which can be recovered by restriction digestion for use in the construction of recombineering substrates, or amplified by PCR using the following targeting sequences:
CGCTCTAGAACTAGTGGATCC
ATGCCTGCAGGTCGACTC
Proper citation: RRID:Addgene_71486 Copy
Species: Synthetic
Genetic Insert: U_(pos36GFP)-Cre
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5181; Vector Backbone:pET29; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26465072
Proper citation: RRID:Addgene_71749 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
