Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: T.maritima
Genetic Insert: SurE
Vector Backbone Description: Backbone Size:5443; Vector Backbone:pET-21a(+); Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11524683
Proper citation: RRID:Addgene_12669 Copy
Species: Homo sapiens
Genetic Insert: RB cterm
Vector Backbone Description: Vector Backbone:pLenti; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32255427
Proper citation: RRID:Addgene_126680 Copy
Species: A. Victoria (Jellyfish), Human promoter
Genetic Insert: eGFP
Vector Backbone Description: Backbone Marker:Derived in Kotton lab; Backbone Size:6978; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31732721
Proper citation: RRID:Addgene_126686 Copy
Species: A. Victoria (Jellyfish), Human promoter
Genetic Insert: nlsGFP
Vector Backbone Description: Backbone Marker:Derived in Kotton lab; Backbone Size:6978; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40458282
Proper citation: RRID:Addgene_126688 Copy
Species: Mycobacterium tuberculosis H37Rv
Genetic Insert: egfp
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3147; Vector Backbone:pGAPZ_ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:31077813
Proper citation: RRID:Addgene_126717 Copy
Genetic Insert: Src42a
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30139739
Proper citation: RRID:Addgene_126674 Copy
Species: Homo sapiens
Genetic Insert: RAB11A (Homo sapiens)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12070301
Proper citation: RRID:Addgene_12680 Copy
Species: Homo sapiens
Genetic Insert: RAB11A (Homo sapiens)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12070301
Proper citation: RRID:Addgene_12679 Copy
Species: Homo sapiens
Genetic Insert: RAB9 (Homo sapiens)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:p-DsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12070301
Proper citation: RRID:Addgene_12676 Copy
Species: Homo sapiens
Genetic Insert: RAB9 (Homo sapiens)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:p-DsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12070301
Comments: This plasmid contains two tandem copies of the Rab9 gene.
Proper citation: RRID:Addgene_12677 Copy
Species: S. pyogenes
Genetic Insert: HiFi SpCas9
Vector Backbone Description: Vector Backbone:pX330-like (without U6-sgRNA coding sequence); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32144253
Comments: pCbh-3xFLAG-NLS-HiFi SpCas9-NLS (without U6-sgRNA coding sequence, with silent mutations).
The lack of sgRNA expression cassette allows for easy testing of various SpCas9 variants with the same sgRNA expressed from a separate plasmid (e.g. pmCherry_gRNA, Addgene# #80457).
For detailed information and plasmid usage, please see the associated publication.
Proper citation: RRID:Addgene_126778 Copy
Species: Homo sapiens
Genetic Insert: GAR1
Vector Backbone Description: Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20351177
Proper citation: RRID:Addgene_126873 Copy
Species: Synthetic
Genetic Insert: IV_CS6_4323_v1
Vector Backbone Description: Backbone Marker:Idem parts registry; Vector Backbone:pSB1A3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30990672
Proper citation: RRID:Addgene_126859 Copy
Species: Synthetic
Genetic Insert: SomArchon
Vector Backbone Description: Backbone Size:4813; Vector Backbone:pAAV-CaMKII; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31597963
Proper citation: RRID:Addgene_126942 Copy
Species: Synthetic
Genetic Insert: SomArchon
Vector Backbone Description: Backbone Size:5052; Vector Backbone:pAAV-FLEX; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31597963
Proper citation: RRID:Addgene_126943 Copy
Species: Synthetic
Genetic Insert: SomArchon
Vector Backbone Description: Backbone Size:5279; Vector Backbone:pAAV-Syn; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31597963
Proper citation: RRID:Addgene_126941 Copy
Species: Homo sapiens
Genetic Insert: 10 repeats of SUMO interacting motif (SIM) from PIASx each separated by (GGS)4
Vector Backbone Description: Backbone Marker:unknown; Backbone Size:6000; Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27374333
Proper citation: RRID:Addgene_126946 Copy
Species: Synthetic
Genetic Insert: SomArchon-P2A-CoChR-Kv2.1
Vector Backbone Description: Backbone Size:5279; Vector Backbone:pAAV-Syn; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31597963
Proper citation: RRID:Addgene_126945 Copy
Genetic Insert: GFPuv
Vector Backbone Description: Backbone Marker:Lucigen; Vector Backbone:pSMART-HC-Kan; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32441815
Comments: Please visit https://www.biorxiv.org/content/10.1101/820787v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_127078 Copy
Vector Backbone Description: Vector Backbone:pLenti (Addgene #86708); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31626775
Comments: Cloning Method: Golden Gate; 3' Cloning Site: aagcaccgactcggtgccac
Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_127173 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.