Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 174 showing 3461 ~ 3480 out of 32,424 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_12669

    This resource has 1+ mentions.

http://www.addgene.org/12669

Species: T.maritima
Genetic Insert: SurE
Vector Backbone Description: Backbone Size:5443; Vector Backbone:pET-21a(+); Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11524683

Proper citation: RRID:Addgene_12669 Copy   

    • RRID:Addgene_126680

    This resource has 1+ mentions.

http://www.addgene.org/126680

Species: Homo sapiens
Genetic Insert: RB cterm
Vector Backbone Description: Vector Backbone:pLenti; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32255427

Proper citation: RRID:Addgene_126680 Copy   

    • RRID:Addgene_126686

    This resource has 1+ mentions.

http://www.addgene.org/126686

Species: A. Victoria (Jellyfish), Human promoter
Genetic Insert: eGFP
Vector Backbone Description: Backbone Marker:Derived in Kotton lab; Backbone Size:6978; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31732721

Proper citation: RRID:Addgene_126686 Copy   

    • RRID:Addgene_126688

    This resource has 1+ mentions.

http://www.addgene.org/126688

Species: A. Victoria (Jellyfish), Human promoter
Genetic Insert: nlsGFP
Vector Backbone Description: Backbone Marker:Derived in Kotton lab; Backbone Size:6978; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40458282

Proper citation: RRID:Addgene_126688 Copy   

    • RRID:Addgene_126717

    This resource has 1+ mentions.

http://www.addgene.org/126717

Species: Mycobacterium tuberculosis H37Rv
Genetic Insert: egfp
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3147; Vector Backbone:pGAPZ_ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:31077813

Proper citation: RRID:Addgene_126717 Copy   

    • RRID:Addgene_126674

    This resource has 1+ mentions.

http://www.addgene.org/126674

Genetic Insert: Src42a
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30139739

Proper citation: RRID:Addgene_126674 Copy   

    • RRID:Addgene_12680

    This resource has 10+ mentions.

http://www.addgene.org/12680

Species: Homo sapiens
Genetic Insert: RAB11A (Homo sapiens)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12070301

Proper citation: RRID:Addgene_12680 Copy   

    • RRID:Addgene_12679

    This resource has 10+ mentions.

http://www.addgene.org/12679

Species: Homo sapiens
Genetic Insert: RAB11A (Homo sapiens)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12070301

Proper citation: RRID:Addgene_12679 Copy   

    • RRID:Addgene_12676

    This resource has 1+ mentions.

http://www.addgene.org/12676

Species: Homo sapiens
Genetic Insert: RAB9 (Homo sapiens)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:p-DsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12070301

Proper citation: RRID:Addgene_12676 Copy   

    • RRID:Addgene_12677

    This resource has 1+ mentions.

http://www.addgene.org/12677

Species: Homo sapiens
Genetic Insert: RAB9 (Homo sapiens)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:p-DsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12070301
Comments: This plasmid contains two tandem copies of the Rab9 gene.

Proper citation: RRID:Addgene_12677 Copy   

http://www.addgene.org/126778

Species: S. pyogenes
Genetic Insert: HiFi SpCas9
Vector Backbone Description: Vector Backbone:pX330-like (without U6-sgRNA coding sequence); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32144253
Comments: pCbh-3xFLAG-NLS-HiFi SpCas9-NLS (without U6-sgRNA coding sequence, with silent mutations). The lack of sgRNA expression cassette allows for easy testing of various SpCas9 variants with the same sgRNA expressed from a separate plasmid (e.g. pmCherry_gRNA, Addgene# #80457). For detailed information and plasmid usage, please see the associated publication.

Proper citation: RRID:Addgene_126778 Copy   

    • RRID:Addgene_126873

    This resource has 1+ mentions.

http://www.addgene.org/126873

Species: Homo sapiens
Genetic Insert: GAR1
Vector Backbone Description: Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20351177

Proper citation: RRID:Addgene_126873 Copy   

    • RRID:Addgene_126859

    This resource has 1+ mentions.

http://www.addgene.org/126859

Species: Synthetic
Genetic Insert: IV_CS6_4323_v1
Vector Backbone Description: Backbone Marker:Idem parts registry; Vector Backbone:pSB1A3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30990672

Proper citation: RRID:Addgene_126859 Copy   

    • RRID:Addgene_126942

    This resource has 1+ mentions.

http://www.addgene.org/126942

Species: Synthetic
Genetic Insert: SomArchon
Vector Backbone Description: Backbone Size:4813; Vector Backbone:pAAV-CaMKII; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31597963

Proper citation: RRID:Addgene_126942 Copy   

    • RRID:Addgene_126943

    This resource has 1+ mentions.

http://www.addgene.org/126943

Species: Synthetic
Genetic Insert: SomArchon
Vector Backbone Description: Backbone Size:5052; Vector Backbone:pAAV-FLEX; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31597963

Proper citation: RRID:Addgene_126943 Copy   

    • RRID:Addgene_126941

    This resource has 1+ mentions.

http://www.addgene.org/126941

Species: Synthetic
Genetic Insert: SomArchon
Vector Backbone Description: Backbone Size:5279; Vector Backbone:pAAV-Syn; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31597963

Proper citation: RRID:Addgene_126941 Copy   

    • RRID:Addgene_126946

    This resource has 1+ mentions.

http://www.addgene.org/126946

Species: Homo sapiens
Genetic Insert: 10 repeats of SUMO interacting motif (SIM) from PIASx each separated by (GGS)4
Vector Backbone Description: Backbone Marker:unknown; Backbone Size:6000; Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27374333

Proper citation: RRID:Addgene_126946 Copy   

http://www.addgene.org/126945

Species: Synthetic
Genetic Insert: SomArchon-P2A-CoChR-Kv2.1
Vector Backbone Description: Backbone Size:5279; Vector Backbone:pAAV-Syn; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31597963

Proper citation: RRID:Addgene_126945 Copy   

    • RRID:Addgene_127078

    This resource has 1+ mentions.

http://www.addgene.org/127078

Genetic Insert: GFPuv
Vector Backbone Description: Backbone Marker:Lucigen; Vector Backbone:pSMART-HC-Kan; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32441815
Comments: Please visit https://www.biorxiv.org/content/10.1101/820787v2 for bioRxiv preprint.

Proper citation: RRID:Addgene_127078 Copy   

    • RRID:Addgene_127173

    This resource has 1+ mentions.

http://www.addgene.org/127173

Vector Backbone Description: Vector Backbone:pLenti (Addgene #86708); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31626775
Comments: Cloning Method: Golden Gate; 3' Cloning Site: aagcaccgactcggtgccac Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_127173 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch