Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pET-21a(+) SurE
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_12669 SurE T.maritima Ampicillin PMID:11524683 Backbone Size:5443; Vector Backbone:pET-21a(+); Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:04:28 1
pLenti-mCherry-CDK4KTR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_126680 RB cterm Homo sapiens Ampicillin PMID:32255427 Vector Backbone:pLenti; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:04:28 2
pHAGE-EF1aL-eGFP-W
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_126686 eGFP A. Victoria (Jellyfish), Human promoter Ampicillin PMID:31732721 Backbone Marker:Derived in Kotton lab; Backbone Size:6978; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:04:28 9
pHAGE-EF1aL-nlsGFP-W
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_126688 nlsGFP A. Victoria (Jellyfish), Human promoter Ampicillin PMID:40458282 Backbone Marker:Derived in Kotton lab; Backbone Size:6978; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:04:28 2
pZ_P-GAP-eGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_126717 egfp Mycobacterium tuberculosis H37Rv Bleocin (Zeocin) PMID:31077813 Backbone Marker:Invitrogen; Backbone Size:3147; Vector Backbone:pGAPZ_ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:04:28 1
pET His10-Src42a
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_126674 Src42a Kanamycin PMID:30139739 Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:04:28 1
DsRed-rab11 DN
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_12680 RAB11A (Homo sapiens) Homo sapiens Kanamycin PMID:12070301 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin changed serine 25 to asparagine 2026-08-15 01:04:29 10
DsRed-rab11 WT
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_12679 RAB11A (Homo sapiens) Homo sapiens Kanamycin PMID:12070301 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:04:29 44
DsRed-rab9 DN
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_12676 RAB9 (Homo sapiens) Homo sapiens Kanamycin PMID:12070301 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:p-DsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin changed serine 21 to asparagine 2026-08-15 01:04:29 4
DsRed-rab9 WT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_12677 RAB9 (Homo sapiens) Homo sapiens Kanamycin PMID:12070301 This plasmid contains two tandem copies of the Rab9 gene. Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:p-DsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:04:29 7
pX330-Flag-HiFi SpCas9 (without sgRNA; with silent mutations)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_126778 HiFi SpCas9 S. pyogenes Ampicillin PMID:32144253 pCbh-3xFLAG-NLS-HiFi SpCas9-NLS (without U6-sgRNA coding sequence, with silent mutations). The lack of sgRNA expression cassette allows for easy testing of various SpCas9 variants with the same sgRNA expressed from a separate plasmid (e.g. pmCherry_gRNA, Addgene# #80457). For detailed information and plasmid usage, please see the associated publication. Vector Backbone:pX330-like (without U6-sgRNA coding sequence); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin R691A 2026-08-15 01:04:29 1
pcDNA3.1 3xF-GAR1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_126873 GAR1 Homo sapiens Ampicillin PMID:20351177 Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:04:30 1
pre_IV_CS6_4323_v1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_126859 IV_CS6_4323_v1 Synthetic Chloramphenicol PMID:30990672 Backbone Marker:Idem parts registry; Vector Backbone:pSB1A3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-08-15 01:04:29 2
pAAV-CaMKII-SomArchon
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_126942 SomArchon Synthetic Ampicillin PMID:31597963 Backbone Size:4813; Vector Backbone:pAAV-CaMKII; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:04:30 1
pAAV-CAG-FLEX-SomArchon
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_126943 SomArchon Synthetic Ampicillin PMID:31597963 Backbone Size:5052; Vector Backbone:pAAV-FLEX; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:04:30 3
pAAV-Syn-SomArchon
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_126941 SomArchon Synthetic Ampicillin PMID:31597963 Backbone Size:5279; Vector Backbone:pAAV-Syn; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:04:30 2
(SIM)10
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_126946 10 repeats of SUMO interacting motif (SIM) from PIASx each separated by (GGS)4 Homo sapiens Ampicillin PMID:27374333 Backbone Marker:unknown; Backbone Size:6000; Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:04:30 1
pAAV-Syn-SomArchon-P2A-CoChR-Kv2.1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_126945 SomArchon-P2A-CoChR-Kv2.1 Synthetic Ampicillin PMID:31597963 Backbone Size:5279; Vector Backbone:pAAV-Syn; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:04:30 1
pHCKan-yibDp-GFPuv
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_127078 GFPuv Kanamycin PMID:32441815 Please visit https://www.biorxiv.org/content/10.1101/820787v2 for bioRxiv preprint. Backbone Marker:Lucigen; Vector Backbone:pSMART-HC-Kan; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:04:32 4
CROPseq-Guide-Zeo
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_127173 Ampicillin PMID:31626775 Cloning Method: Golden Gate; 3' Cloning Site: aagcaccgactcggtgccac Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint. Vector Backbone:pLenti (Addgene #86708); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:04:33 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch