Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 175 showing 3481 ~ 3500 out of 32,424 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_127172

    This resource has 1+ mentions.

http://www.addgene.org/127172

Species: Homo sapiens
Genetic Insert: GFP-RelA
Vector Backbone Description: Vector Backbone:pLenti (Addgene #61427); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31626775
Comments: Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_127172 Copy   

    • RRID:Addgene_127170

    This resource has 1+ mentions.

http://www.addgene.org/127170

Genetic Insert: None
Vector Backbone Description: Vector Backbone:pLenti (Addgene #61427); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31626775
Comments: Cloning Method: Golden Gate; Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_127170 Copy   

    • RRID:Addgene_127168

    This resource has 1+ mentions.

http://www.addgene.org/127168

Vector Backbone Description: Vector Backbone:pLenti (Addgene #61427); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31626775
Comments: Cloning Method: Two-step Golden Gate; Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_127168 Copy   

    • RRID:Addgene_127161

    This resource has 1+ mentions.

http://www.addgene.org/127161

Species: Homo sapiens
Genetic Insert: MB21D1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4114; Vector Backbone:pRSFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31113940

Proper citation: RRID:Addgene_127161 Copy   

    • RRID:Addgene_127157

    This resource has 1+ mentions.

http://www.addgene.org/127157

Species: Mus musculus
Genetic Insert: Igkc
Vector Backbone Description: Backbone Size:5729; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33268892
Comments: ENA accession: LR588433, https://www.ebi.ac.uk/ena/browser/view/LR588433

Proper citation: RRID:Addgene_127157 Copy   

    • RRID:Addgene_127156

    This resource has 1+ mentions.

http://www.addgene.org/127156

Species: Mus musculus
Genetic Insert: Iglc2
Vector Backbone Description: Backbone Size:5729; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33268892
Comments: ENA accession: LR588434, https://www.ebi.ac.uk/ena/browser/view/LR588434

Proper citation: RRID:Addgene_127156 Copy   

    • RRID:Addgene_127098

    This resource has 1+ mentions.

http://www.addgene.org/127098

Species: Homo sapiens
Genetic Insert: Cas9-2A-eGFP
Vector Backbone Description: Vector Backbone:lentiCRISPR v2; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_127098 Copy   

http://www.addgene.org/127090

Species: C. reinhardtii
Genetic Insert: Channelrhodopsin-2
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31028266
Comments: *Note: This construct is based on Addgene ID 20298 (the Ef1a promoter was changed to the CAG promoter).

Proper citation: RRID:Addgene_127090 Copy   

    • RRID:Addgene_127093

    This resource has 1+ mentions.

http://www.addgene.org/127093

Species: Homo sapiens
Genetic Insert: EGFP - 3 repeats of human SUMO3 each separated by (GGS)4
Vector Backbone Description: Backbone Marker:unknown; Backbone Size:5000; Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27374333

Proper citation: RRID:Addgene_127093 Copy   

    • RRID:Addgene_127190

    This resource has 1+ mentions.

http://www.addgene.org/127190

Species: Other
Genetic Insert: Firefly luciferase
Vector Backbone Description: Backbone Size:6466; Vector Backbone:PB-CAG-GAPd2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_127190 Copy   

    • RRID:Addgene_127193

    This resource has 1+ mentions.

http://www.addgene.org/127193

Species: Homo sapiens
Genetic Insert: FUS 1-163 S12xQ
Vector Backbone Description: Vector Backbone:RP1B; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31270472

Proper citation: RRID:Addgene_127193 Copy   

    • RRID:Addgene_127192

    This resource has 1+ mentions.

http://www.addgene.org/127192

Species: Homo sapiens
Genetic Insert: FUS 1-163
Vector Backbone Description: Vector Backbone:RP1B; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31270472

Proper citation: RRID:Addgene_127192 Copy   

    • RRID:Addgene_127239

    This resource has 1+ mentions.

http://www.addgene.org/127239

Genetic Insert: ChRger2-TS-EYFP
Vector Backbone Description: Backbone Size:5457; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31611694

Proper citation: RRID:Addgene_127239 Copy   

    • RRID:Addgene_127229

    This resource has 1+ mentions.

http://www.addgene.org/127229

Species: A. tumefaciens
Genetic Insert: IPT
Vector Backbone Description: Backbone Marker:Cambia; Vector Backbone:pMOD_D4800EC; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31844292

Proper citation: RRID:Addgene_127229 Copy   

    • RRID:Addgene_127219

    This resource has 1+ mentions.

http://www.addgene.org/127219

Species: Maize
Genetic Insert: WUS2
Vector Backbone Description: Backbone Marker:Voytas Lab; Vector Backbone:pMOD_C'4800EC; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31844292

Proper citation: RRID:Addgene_127219 Copy   

    • RRID:Addgene_127393

    This resource has 1+ mentions.

http://www.addgene.org/127393

Species: Mus musculus
Genetic Insert: Calmodulin 1
Vector Backbone Description: Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31239443

Proper citation: RRID:Addgene_127393 Copy   

    • RRID:Addgene_127384

    This resource has 1+ mentions.

http://www.addgene.org/127384

Genetic Insert: uORF(M)-Cas9
Vector Backbone Description: Backbone Marker:Johannes Bischof and Konrad Basler; Vector Backbone:pUASTattB; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32053108

Proper citation: RRID:Addgene_127384 Copy   

    • RRID:Addgene_127383

    This resource has 1+ mentions.

http://www.addgene.org/127383

Species: Other
Genetic Insert: uORF(S)-Cas9
Vector Backbone Description: Backbone Marker:Johannes Bischof and Konrad Basler; Vector Backbone:pUASTattB; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32053108

Proper citation: RRID:Addgene_127383 Copy   

    • RRID:Addgene_127389

    This resource has 1+ mentions.

http://www.addgene.org/127389

Species: Rattus norvegicus
Genetic Insert: calcium/calmodulin-dependent protein kinase II alpha
Vector Backbone Description: Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31239443

Proper citation: RRID:Addgene_127389 Copy   

    • RRID:Addgene_127347

    This resource has 1+ mentions.

http://www.addgene.org/127347

Species: Synthetic
Genetic Insert: Red Fluorescent Protein
Vector Backbone Description: Backbone Marker:Allan Gurtan (Phil Sharp Lab); Vector Backbone:pCAGGs; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_127347 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch