Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Wnt5A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22784633
Proper citation: RRID:Addgene_35874 Copy
Species: Homo sapiens
Genetic Insert: Wnt5B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22784633
Proper citation: RRID:Addgene_35875 Copy
Species: Homo sapiens
Genetic Insert: Wnt7A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22784633
Proper citation: RRID:Addgene_35914 Copy
Species: Homo sapiens
Genetic Insert: Wnt6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22784633
Proper citation: RRID:Addgene_35913 Copy
Species: Mus musculus
Genetic Insert: zfp423 shRNA
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20200519
Comments: Forward Oligo 5'
CCGGCCCTGAATGTAACGTGAAGTTCTCGAGAACTTCACGTTACATTCAGGGTTTTTG 3'
Reverse Oligo 5'
AATTCAAAAACCCTGAATGTAACGTGAAGTTCTCGAGAACTTCACGTTACATTCAGGG 3'
Proper citation: RRID:Addgene_35972 Copy
Species: Homo sapiens
Genetic Insert: heterogeneous nuclear ribonucleoprotein U
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25613133
Proper citation: RRID:Addgene_35974 Copy
Vector Backbone Description: Backbone Marker:Naldini Lab; Backbone Size:6782; Vector Backbone:pRRLsinPPT-CMV-MCS-WPRE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23792206
Comments: The backbone is described the Naldini group in Dull et al., 1998 (JVI) and was modified by Anthony Oliva and Jia Pingping at the Miami project.
Proper citation: RRID:Addgene_36097 Copy
Species: Homo sapiens
Genetic Insert: FYVE(EEA1) domain
Vector Backbone Description: Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9702203
Proper citation: RRID:Addgene_36096 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 2xPH(Osh2) fusion
Vector Backbone Description: Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21295699
Comments: Please note that the first Osh2 domain contains aa273-421 and the second Osh2 domains contains aa260-421 when compared to GenBank reference sequence NP_010265.1. According to this reference sequence the PH domain is aa 292–384. The additional residues surrounding the PH domain were intentionally cloned into this construct.
Proper citation: RRID:Addgene_36095 Copy
Vector Backbone Description: Backbone Size:5450; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20671728
Comments: After mammal transfection, supplement fresh media with 4 uM Biotin to "charge" tag by Biotin. Allow cells to grow for about 48 h before the purification steps.
Proper citation: RRID:Addgene_36099 Copy
Species: Synthetic
Genetic Insert: pEBFP2-Nuc
Vector Backbone Description: Backbone Size:6782; Vector Backbone:pLenti-MP2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: The backbone is described the Naldini group in Dull et al., 1998 (JVI) and was modified by Anthony Oliva and Jia Pingping at the Miami project.
Proper citation: RRID:Addgene_36085 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:6782; Vector Backbone:pLenti-MP2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: The backbone is described the Naldini group in Dull et al., 1998 (JVI) and was modified by Anthony Oliva and Jia Pingping at the Miami project.
Proper citation: RRID:Addgene_36084 Copy
Species: Homo sapiens
Genetic Insert: cyclophilin B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7767; Vector Backbone:pcDNA-DEST53; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22426501
Comments: Please note that Addgene's sequencing results identified a A212S mutation when compared to GenBank reference NP_000933.1
Proper citation: RRID:Addgene_36123 Copy
Species: Mus musculus
Genetic Insert: G protein beta subunit B4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17581822
Proper citation: RRID:Addgene_36114 Copy
Species: Homo sapiens
Genetic Insert: PH domain of PLCdelta1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19936219
Proper citation: RRID:Addgene_36075 Copy
Species: Bos taurus
Genetic Insert: G protein G9(gamma 3 tail)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19936219
Comments: Mutagenesis was used to replace the last 15 residues of gamma 9 with those of gamma 3.
Proper citation: RRID:Addgene_36074 Copy
Species: Bos taurus
Genetic Insert: G protein subunit Gamma 9
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17581822
Proper citation: RRID:Addgene_36107 Copy
Species: Mus musculus
Genetic Insert: Pax2
Vector Backbone Description: Backbone Size:7164; Vector Backbone:pCMVbeta; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11032856
Proper citation: RRID:Addgene_36052 Copy
Species: Homo sapiens
Genetic Insert: alpha-synuclein WT
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4581; Vector Backbone:pAAV-MCS; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22302797
Comments: Lashuel Lab Plasmid #172
Proper citation: RRID:Addgene_36055 Copy
Species: Danio rerio
Genetic Insert: TAL array targeting ptp4a3
Vector Backbone Description: Vector Backbone:JDS 70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Proper citation: RRID:Addgene_35993 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.