Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Mentions:yes (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
Wnt5A STOP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_35874 Wnt5A Homo sapiens Kanamycin PMID:22784633 Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin None 2026-08-15 01:14:07 1
Wnt5B STOP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_35875 Wnt5B Homo sapiens Kanamycin PMID:22784633 Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin None 2026-08-15 01:14:03 1
pcDNA-Wnt7A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_35914 Wnt7A Homo sapiens Ampicillin PMID:22784633 Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin None 2026-08-15 01:14:04 3
pcDNA-Wnt6
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_35913 Wnt6 Homo sapiens Ampicillin PMID:22784633 Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Silent Mutation G (567) --> A 2026-08-15 01:14:07 1
pMKO.1-Zfp423
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_35972 zfp423 shRNA Mus musculus Ampicillin PMID:20200519 Forward Oligo 5' CCGGCCCTGAATGTAACGTGAAGTTCTCGAGAACTTCACGTTACATTCAGGGTTTTTG 3' Reverse Oligo 5' AATTCAAAAACCCTGAATGTAACGTGAAGTTCTCGAGAACTTCACGTTACATTCAGGG 3' Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:14:04 2
pcDNA3.1-hnRNPU-V5
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_35974 heterogeneous nuclear ribonucleoprotein U Homo sapiens Ampicillin PMID:25613133 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:08 4
pLenti-MP2
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_36097 Ampicillin PMID:23792206 The backbone is described the Naldini group in Dull et al., 1998 (JVI) and was modified by Anthony Oliva and Jia Pingping at the Miami project. Backbone Marker:Naldini Lab; Backbone Size:6782; Vector Backbone:pRRLsinPPT-CMV-MCS-WPRE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:05 11
pRS424GFP-FYVE(EEA1)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_36096 FYVE(EEA1) domain Homo sapiens Ampicillin PMID:9702203 Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:08 4
pRS424GFP-2xPH(Osh2)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_36095 2xPH(Osh2) fusion Saccharomyces cerevisiae Ampicillin PMID:21295699 Please note that the first Osh2 domain contains aa273-421 and the second Osh2 domains contains aa260-421 when compared to GenBank reference sequence NP_010265.1. According to this reference sequence the PH domain is aa 292–384. The additional residues surrounding the PH domain were intentionally cloned into this construct. Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:05 2
pEBB-TB
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_36099 Ampicillin PMID:20671728 After mammal transfection, supplement fresh media with 4 uM Biotin to "charge" tag by Biotin. Allow cells to grow for about 48 h before the purification steps. Backbone Size:5450; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:08 1
pLV-EBFP2-nuc
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_36085 pEBFP2-Nuc Synthetic Ampicillin The backbone is described the Naldini group in Dull et al., 1998 (JVI) and was modified by Anthony Oliva and Jia Pingping at the Miami project. Backbone Size:6782; Vector Backbone:pLenti-MP2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Replace EYFP of the vector pEYFP-Nuc from Clontech with EBFP2. 2026-08-15 01:14:05 6
pLV-mCherry
 
Resource Report
Resource Website
50+ mentions
RRID:Addgene_36084 mCherry Synthetic Ampicillin The backbone is described the Naldini group in Dull et al., 1998 (JVI) and was modified by Anthony Oliva and Jia Pingping at the Miami project. Backbone Size:6782; Vector Backbone:pLenti-MP2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:05 91
PcDNA-DEST53-CypB-Nucl N-term GFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_36123 cyclophilin B Homo sapiens Ampicillin PMID:22426501 Please note that Addgene's sequencing results identified a A212S mutation when compared to GenBank reference NP_000933.1 Backbone Marker:Invitrogen; Backbone Size:7767; Vector Backbone:pcDNA-DEST53; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin A212S 2026-08-15 01:14:08 1
mcherry Beta 4
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_36114 G protein beta subunit B4 Mus musculus Ampicillin PMID:17581822 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:05 1
mcherry-PH
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_36075 PH domain of PLCdelta1 Homo sapiens Ampicillin PMID:19936219 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:05 9
YFP-Gamma 9-3
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_36074 G protein G9(gamma 3 tail) Bos taurus Ampicillin PMID:19936219 Mutagenesis was used to replace the last 15 residues of gamma 9 with those of gamma 3. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin HIs tag between YFP and insert 2026-08-15 01:14:05 1
YFP Gamma 9
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_36107 G protein subunit Gamma 9 Bos taurus Ampicillin PMID:17581822 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin HIs tag between YFP and insert 2026-08-15 01:14:05 1
pCMV-Pax2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_36052 Pax2 Mus musculus Ampicillin PMID:11032856 Backbone Size:7164; Vector Backbone:pCMVbeta; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:05 4
pAAV asyn WT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_36055 alpha-synuclein WT Homo sapiens Ampicillin PMID:22302797 Lashuel Lab Plasmid #172 Backbone Marker:Stratagene; Backbone Size:4581; Vector Backbone:pAAV-MCS; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:14:05 9
ptp4a3_R (TAL 3001)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_35993 TAL array targeting ptp4a3 Danio rerio Ampicillin PMID:21822241 Vector Backbone:JDS 70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:04 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.