Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Wnt5A STOP Resource Report Resource Website 1+ mentions |
RRID:Addgene_35874 | Wnt5A | Homo sapiens | Kanamycin | PMID:22784633 | Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | None | 2026-08-15 01:14:07 | 1 | |
|
Wnt5B STOP Resource Report Resource Website 1+ mentions |
RRID:Addgene_35875 | Wnt5B | Homo sapiens | Kanamycin | PMID:22784633 | Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | None | 2026-08-15 01:14:03 | 1 | |
|
pcDNA-Wnt7A Resource Report Resource Website 1+ mentions |
RRID:Addgene_35914 | Wnt7A | Homo sapiens | Ampicillin | PMID:22784633 | Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | None | 2026-08-15 01:14:04 | 3 | |
|
pcDNA-Wnt6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_35913 | Wnt6 | Homo sapiens | Ampicillin | PMID:22784633 | Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Silent Mutation G (567) --> A | 2026-08-15 01:14:07 | 1 | |
|
pMKO.1-Zfp423 Resource Report Resource Website 1+ mentions |
RRID:Addgene_35972 | zfp423 shRNA | Mus musculus | Ampicillin | PMID:20200519 | Forward Oligo 5' CCGGCCCTGAATGTAACGTGAAGTTCTCGAGAACTTCACGTTACATTCAGGGTTTTTG 3' Reverse Oligo 5' AATTCAAAAACCCTGAATGTAACGTGAAGTTCTCGAGAACTTCACGTTACATTCAGGG 3' | Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:04 | 2 | |
|
pcDNA3.1-hnRNPU-V5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_35974 | heterogeneous nuclear ribonucleoprotein U | Homo sapiens | Ampicillin | PMID:25613133 | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:08 | 4 | ||
|
pLenti-MP2 Resource Report Resource Website 10+ mentions |
RRID:Addgene_36097 | Ampicillin | PMID:23792206 | The backbone is described the Naldini group in Dull et al., 1998 (JVI) and was modified by Anthony Oliva and Jia Pingping at the Miami project. | Backbone Marker:Naldini Lab; Backbone Size:6782; Vector Backbone:pRRLsinPPT-CMV-MCS-WPRE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:05 | 11 | |||
|
pRS424GFP-FYVE(EEA1) Resource Report Resource Website 1+ mentions |
RRID:Addgene_36096 | FYVE(EEA1) domain | Homo sapiens | Ampicillin | PMID:9702203 | Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:08 | 4 | ||
|
pRS424GFP-2xPH(Osh2) Resource Report Resource Website 1+ mentions |
RRID:Addgene_36095 | 2xPH(Osh2) fusion | Saccharomyces cerevisiae | Ampicillin | PMID:21295699 | Please note that the first Osh2 domain contains aa273-421 and the second Osh2 domains contains aa260-421 when compared to GenBank reference sequence NP_010265.1. According to this reference sequence the PH domain is aa 292–384. The additional residues surrounding the PH domain were intentionally cloned into this construct. | Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:05 | 2 | |
|
pEBB-TB Resource Report Resource Website 1+ mentions |
RRID:Addgene_36099 | Ampicillin | PMID:20671728 | After mammal transfection, supplement fresh media with 4 uM Biotin to "charge" tag by Biotin. Allow cells to grow for about 48 h before the purification steps. | Backbone Size:5450; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:08 | 1 | |||
|
pLV-EBFP2-nuc Resource Report Resource Website 1+ mentions |
RRID:Addgene_36085 | pEBFP2-Nuc | Synthetic | Ampicillin | The backbone is described the Naldini group in Dull et al., 1998 (JVI) and was modified by Anthony Oliva and Jia Pingping at the Miami project. | Backbone Size:6782; Vector Backbone:pLenti-MP2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Replace EYFP of the vector pEYFP-Nuc from Clontech with EBFP2. | 2026-08-15 01:14:05 | 6 | |
|
pLV-mCherry Resource Report Resource Website 50+ mentions |
RRID:Addgene_36084 | mCherry | Synthetic | Ampicillin | The backbone is described the Naldini group in Dull et al., 1998 (JVI) and was modified by Anthony Oliva and Jia Pingping at the Miami project. | Backbone Size:6782; Vector Backbone:pLenti-MP2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:05 | 91 | ||
|
PcDNA-DEST53-CypB-Nucl N-term GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_36123 | cyclophilin B | Homo sapiens | Ampicillin | PMID:22426501 | Please note that Addgene's sequencing results identified a A212S mutation when compared to GenBank reference NP_000933.1 | Backbone Marker:Invitrogen; Backbone Size:7767; Vector Backbone:pcDNA-DEST53; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | A212S | 2026-08-15 01:14:08 | 1 |
|
mcherry Beta 4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_36114 | G protein beta subunit B4 | Mus musculus | Ampicillin | PMID:17581822 | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:05 | 1 | ||
|
mcherry-PH Resource Report Resource Website 1+ mentions |
RRID:Addgene_36075 | PH domain of PLCdelta1 | Homo sapiens | Ampicillin | PMID:19936219 | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:05 | 9 | ||
|
YFP-Gamma 9-3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_36074 | G protein G9(gamma 3 tail) | Bos taurus | Ampicillin | PMID:19936219 | Mutagenesis was used to replace the last 15 residues of gamma 9 with those of gamma 3. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | HIs tag between YFP and insert | 2026-08-15 01:14:05 | 1 |
|
YFP Gamma 9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_36107 | G protein subunit Gamma 9 | Bos taurus | Ampicillin | PMID:17581822 | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | HIs tag between YFP and insert | 2026-08-15 01:14:05 | 1 | |
|
pCMV-Pax2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_36052 | Pax2 | Mus musculus | Ampicillin | PMID:11032856 | Backbone Size:7164; Vector Backbone:pCMVbeta; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:05 | 4 | ||
|
pAAV asyn WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_36055 | alpha-synuclein WT | Homo sapiens | Ampicillin | PMID:22302797 | Lashuel Lab Plasmid #172 | Backbone Marker:Stratagene; Backbone Size:4581; Vector Backbone:pAAV-MCS; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:05 | 9 | |
|
ptp4a3_R (TAL 3001) Resource Report Resource Website 1+ mentions |
RRID:Addgene_35993 | TAL array targeting ptp4a3 | Danio rerio | Ampicillin | PMID:21822241 | Vector Backbone:JDS 70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:04 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.