Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: sgAAVS1
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336569
Comments: For more information on OE-PCR please see: http://en.wikipedia.org/wiki/Overlap_extension_polymerase_chain_reaction)
gRNA target sequence GGGGCCACTAGGGACAGGAT
Proper citation: RRID:Addgene_50662 Copy
Genetic Insert: humanized S. pyogenes Cas9
Vector Backbone Description: Backbone Size:7600; Vector Backbone:pCW57.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336569
Comments: Depositors used delta-VPR and CMV VSV-G packaging plasmids
Proper citation: RRID:Addgene_50661 Copy
Species: Xanthamonas oryzae
Genetic Insert: repeat 1HD
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24287550
Proper citation: RRID:Addgene_50664 Copy
Species: Xanthamonas oryzae
Genetic Insert: repeat 1NI
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24287550
Proper citation: RRID:Addgene_50666 Copy
Species: Xanthamonas oryzae
Genetic Insert: repeat 1NG
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24287550
Proper citation: RRID:Addgene_50665 Copy
Species: Xanthamonas oryzae
Genetic Insert: repeat 2NI
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24287550
Proper citation: RRID:Addgene_50670 Copy
Species: Xanthamonas oryzae
Genetic Insert: repeat 4NI
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24287550
Proper citation: RRID:Addgene_50678 Copy
Species: Xanthamonas oryzae
Genetic Insert: repeat 3NN
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24287550
Proper citation: RRID:Addgene_50675 Copy
Species: Homo sapiens
Genetic Insert: Triosephosphate isomerase 1
Vector Backbone Description: Backbone Size:5805; Vector Backbone:p413GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24598263
Proper citation: RRID:Addgene_50722 Copy
Species: Homo sapiens
Genetic Insert: Triosephosphate isomerase 1
Vector Backbone Description: Backbone Size:3591; Vector Backbone:pET20b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24598263
Proper citation: RRID:Addgene_50724 Copy
Species: Homo sapiens
Genetic Insert: Triosephosphate isomerase 1
Vector Backbone Description: Backbone Size:5805; Vector Backbone:p413GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24598263
Proper citation: RRID:Addgene_50720 Copy
Species: Homo sapiens
Genetic Insert: Cortactin
Vector Backbone Description: Backbone Marker:Yamada Lab; Vector Backbone:pRK VSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: 12AA missing in actin -binding domain was restored by site sirected mutagenesis.
Proper citation: RRID:Addgene_50727 Copy
Species: Homo sapiens
Genetic Insert: Triosephosphate isomerase 1
Vector Backbone Description: Backbone Size:3591; Vector Backbone:pET20b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24598263
Proper citation: RRID:Addgene_50726 Copy
Species: Homo sapiens
Genetic Insert: EWSR1 G511A
Vector Backbone Description: Backbone Marker:Iain Fraser(Addgene plasmid #25735); Backbone Size:13286; Vector Backbone:pSLIK-neo; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22454397
Proper citation: RRID:Addgene_50734 Copy
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Marker:Iain Fraser(Addgene plasmid #25735); Backbone Size:13286; Vector Backbone:pSLIK-neo; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22454397
Proper citation: RRID:Addgene_50733 Copy
Species: Homo sapiens
Genetic Insert: CrkII
Vector Backbone Description: Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_50730 Copy
Species: Xanthamonas oryzae
Genetic Insert: TALEN-FokI nuclease backbone
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24287550
Proper citation: RRID:Addgene_50699 Copy
Species: Homo sapiens
Genetic Insert: CrkII Y221F
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12799422
Proper citation: RRID:Addgene_50732 Copy
Species: Homo sapiens
Genetic Insert: CrkII
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12799422
Proper citation: RRID:Addgene_50731 Copy
Species: P. falciparum
Genetic Insert: Prohibitin
Vector Backbone Description: Backbone Marker:Yves Durocher; Backbone Size:6670; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24620899
Comments: Made by gene synthesis
Proper citation: RRID:Addgene_50800 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
