Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: Ef1a promoter, EGFP gene, C-terminal HA tag, SV40 promoter, and Zeocin Resistance gene
Vector Backbone Description: Backbone Marker:Cell Biolabs, Inc; Backbone Size:4796; Vector Backbone:pSMPUW-eMCS; Vector Types:Lentiviral; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_128455 Copy
Species: P. aeruginosa
Genetic Insert: Exotoxin A
Vector Backbone Description: Backbone Size:1765; Vector Backbone:pJL1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33536221
Proper citation: RRID:Addgene_128397 Copy
Species: C. diphtheriae
Genetic Insert: Diphtheria toxin
Vector Backbone Description: Backbone Size:1765; Vector Backbone:pJL1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33536221
Proper citation: RRID:Addgene_128395 Copy
Vector Backbone Description: Backbone Size:2739; Vector Backbone:pTAKN-2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_128433 Copy
Species: E. coli
Genetic Insert: Maltose binding protein
Vector Backbone Description: Backbone Size:1765; Vector Backbone:pJL1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33536221
Comments: Depositor confirms mutation does not affect plasmid function.
Proper citation: RRID:Addgene_128390 Copy
Species: N. meningitidis
Genetic Insert: PorA
Vector Backbone Description: Backbone Size:1765; Vector Backbone:pJL1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33536221
Proper citation: RRID:Addgene_128392 Copy
Species: H. influenzae
Genetic Insert: Protein D
Vector Backbone Description: Backbone Size:1765; Vector Backbone:pJL1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33536221
Proper citation: RRID:Addgene_128391 Copy
Species: Streptococcus pyogenes serotype M1
Genetic Insert: GRAB (V34-N181)
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:5369; Vector Backbone:pCri8a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31235767
Comments: Reverse primer 1: CGAATTGTGGATGGCTCCAACCTCCATTAACGTTCTGACGTTC
Reverse primer 2: CTTCCACCTCCAGAACCTCCACCCTTTTCGAATTGTGGATGGCTCC3
Reverse primer 3: GTGGATGGCTCCATGCGCTACCTCCACTTCCACCTCCAGAAC
Proper citation: RRID:Addgene_128499 Copy
Species: Streptococcus pyogenes serotype M1
Genetic Insert: GRAB (Streptococcus pyogenes serotype M1)
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:5369; Vector Backbone:pCri8a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31235767
Proper citation: RRID:Addgene_128498 Copy
Species: Homo sapiens
Genetic Insert: Myosin IIB
Vector Backbone Description: Backbone Size:3963; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30540249
Proper citation: RRID:Addgene_128574 Copy
Species: Pseudomonas syringae
Genetic Insert: HopAD1
Vector Backbone Description: Vector Backbone:pENTR/SD/D-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26067603
Comments: Also reference: PMID 29742421.
Addgene QC identified an unexpected IS element present in the plasmid backbone. The depositing lab does not believe this to be of functional concern but requesting scientists should confirm the functionality of the construct prior to experimentation.
Proper citation: RRID:Addgene_128731 Copy
Species: Pseudomonas syringae
Genetic Insert: HopAO1
Vector Backbone Description: Vector Backbone:pENTR/SD/D-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18321194
Comments: Also reference: PMID 29742421.
Proper citation: RRID:Addgene_128730 Copy
Species: Pseudomonas syringae
Genetic Insert: hopT1-1
Vector Backbone Description: Vector Backbone:pENTR/SD/D-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18321194
Comments: Also reference: PMID 29742421.
Proper citation: RRID:Addgene_128720 Copy
Species: Pseudomonas syringae
Genetic Insert: hopAA1-1
Vector Backbone Description: Vector Backbone:pENTR/SD/D-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18321194
Comments: Also reference: PMID 29742421.
Proper citation: RRID:Addgene_128725 Copy
Species: Pseudomonas syringae
Genetic Insert: hopY1
Vector Backbone Description: Vector Backbone:pENTR/SD/D-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18321194
Comments: Also reference: PMID 29742421.
Proper citation: RRID:Addgene_128724 Copy
Species: Pseudomonas syringae
Genetic Insert: hopX1
Vector Backbone Description: Vector Backbone:pENTR/SD/D-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18321194
Comments: Also reference: PMID 29742421.
Proper citation: RRID:Addgene_128723 Copy
Species: Pseudomonas syringae
Genetic Insert: hopAM1
Vector Backbone Description: Vector Backbone:pDONR201; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18321194
Comments: Also reference: PMID 29742421.
Proper citation: RRID:Addgene_128729 Copy
Species: Pseudomonas syringae
Genetic Insert: hopAF1
Vector Backbone Description: Vector Backbone:pENTR/SD/D-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18321194
Comments: Also reference: PMID 29742421.
Proper citation: RRID:Addgene_128728 Copy
Species: Pseudomonas syringae
Genetic Insert: avrPtoB
Vector Backbone Description: Vector Backbone:pENTR/SD/D-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18321194
Comments: Also reference: PMID 29742421.
Proper citation: RRID:Addgene_128727 Copy
Species: Pseudomonas syringae
Genetic Insert: hopAA1-2
Vector Backbone Description: Vector Backbone:pENTR/SD/D-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18321194
Comments: Also reference: PMID 29742421.
Proper citation: RRID:Addgene_128726 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
