Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pLX-sgRNA Resource Report Resource Website 50+ mentions |
RRID:Addgene_50662 | sgAAVS1 | Ampicillin | PMID:24336569 | For more information on OE-PCR please see: http://en.wikipedia.org/wiki/Overlap_extension_polymerase_chain_reaction) gRNA target sequence GGGGCCACTAGGGACAGGAT | Backbone Size:7000; Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:07 | 85 | ||
|
pCW-Cas9 Resource Report Resource Website 100+ mentions |
RRID:Addgene_50661 | humanized S. pyogenes Cas9 | Ampicillin | PMID:24336569 | Depositors used delta-VPR and CMV VSV-G packaging plasmids | Backbone Size:7600; Vector Backbone:pCW57.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:07 | 239 | ||
|
p1HD Resource Report Resource Website |
RRID:Addgene_50664 | repeat 1HD | Xanthamonas oryzae | Ampicillin | PMID:24287550 | Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 0 | ||
|
p1NI Resource Report Resource Website |
RRID:Addgene_50666 | repeat 1NI | Xanthamonas oryzae | Ampicillin | PMID:24287550 | Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:07 | 0 | ||
|
p1NG Resource Report Resource Website |
RRID:Addgene_50665 | repeat 1NG | Xanthamonas oryzae | Ampicillin | PMID:24287550 | Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:07 | 0 | ||
|
p2NI Resource Report Resource Website |
RRID:Addgene_50670 | repeat 2NI | Xanthamonas oryzae | Ampicillin | PMID:24287550 | Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 0 | ||
|
p4NI Resource Report Resource Website |
RRID:Addgene_50678 | repeat 4NI | Xanthamonas oryzae | Ampicillin | PMID:24287550 | Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:08 | 0 | ||
|
p3NN Resource Report Resource Website |
RRID:Addgene_50675 | repeat 3NN | Xanthamonas oryzae | Ampicillin | PMID:24287550 | Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:08 | 0 | ||
|
p413GPD-hTPI Lys13Arg Resource Report Resource Website |
RRID:Addgene_50722 | Triosephosphate isomerase 1 | Homo sapiens | Ampicillin | PMID:24598263 | Backbone Size:5805; Vector Backbone:p413GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | changed Lysine 13 to Argenine | 2026-08-15 01:16:08 | 0 | |
|
pET20b- hTPI Ile170Val Resource Report Resource Website |
RRID:Addgene_50724 | Triosephosphate isomerase 1 | Homo sapiens | Ampicillin | PMID:24598263 | Backbone Size:3591; Vector Backbone:pET20b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | changed Isoleucine 170 to Valine | 2026-08-15 01:16:10 | 0 | |
|
p413GPD-hTPI Ile170Val Resource Report Resource Website |
RRID:Addgene_50720 | Triosephosphate isomerase 1 | Homo sapiens | Ampicillin | PMID:24598263 | Backbone Size:5805; Vector Backbone:p413GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Isoleucine 170 to Valine | 2026-08-15 01:16:08 | 0 | |
|
pRK VSV Cortactin Resource Report Resource Website |
RRID:Addgene_50727 | Cortactin | Homo sapiens | Ampicillin | 12AA missing in actin -binding domain was restored by site sirected mutagenesis. | Backbone Marker:Yamada Lab; Vector Backbone:pRK VSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 0 | ||
|
pET20b- hTPI Lys13Arg Resource Report Resource Website |
RRID:Addgene_50726 | Triosephosphate isomerase 1 | Homo sapiens | Ampicillin | PMID:24598263 | Backbone Size:3591; Vector Backbone:pET20b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | changed Lysine 13 to Argenine | 2026-08-15 01:16:08 | 0 | |
|
pSLIK-NFLAG-hEWSR1G511A-CMyc Resource Report Resource Website 1+ mentions |
RRID:Addgene_50734 | EWSR1 G511A | Homo sapiens | Ampicillin | PMID:22454397 | Backbone Marker:Iain Fraser(Addgene plasmid #25735); Backbone Size:13286; Vector Backbone:pSLIK-neo; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | Changed Gly 511 to Ala | 2026-08-15 01:16:08 | 1 | |
|
pSLIK-NFLAG-hEWSR1WT-CMyc Resource Report Resource Website 1+ mentions |
RRID:Addgene_50733 | EWSR1 | Homo sapiens | Ampicillin | PMID:22454397 | Backbone Marker:Iain Fraser(Addgene plasmid #25735); Backbone Size:13286; Vector Backbone:pSLIK-neo; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 1 | ||
|
pGFP CrkII Resource Report Resource Website 1+ mentions |
RRID:Addgene_50730 | CrkII | Homo sapiens | Ampicillin | Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 2 | |||
|
ptCMV-136/63-VR-HD Resource Report Resource Website |
RRID:Addgene_50699 | TALEN-FokI nuclease backbone | Xanthamonas oryzae | Ampicillin | PMID:24287550 | Vector Backbone:pCMV; Vector Types:TALEN; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 0 | ||
|
pCDNA CrkII Y221F Resource Report Resource Website |
RRID:Addgene_50732 | CrkII Y221F | Homo sapiens | Ampicillin | PMID:12799422 | Backbone Marker:Invitrogen; Vector Backbone:pCDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Y221F | 2026-08-15 01:16:08 | 0 | |
|
pCDNA3 CrkII Resource Report Resource Website |
RRID:Addgene_50731 | CrkII | Homo sapiens | Ampicillin | PMID:12799422 | Backbone Marker:Invitrogen; Vector Backbone:pCDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:08 | 0 | ||
|
Prohibitin-bio-His Resource Report Resource Website |
RRID:Addgene_50800 | Prohibitin | P. falciparum | Ampicillin | PMID:24620899 | Made by gene synthesis | Backbone Marker:Yves Durocher; Backbone Size:6670; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | all potential N-linked glycosylation sites (N-X-S/T, where X is not proline) were systematically removed by substituting alanine for serine/threonine at these sites. | 2026-08-15 01:16:08 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.