Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCALNL-tdTomato-2A-mSyp::EGFP Resource Report Resource Website |
RRID:Addgene_191213 | tdTomato-T2A-mSyp::EGFP | Mus musculus | Ampicillin | PMID:36386881 | Suggested primers to sequence the insert: 5' ccttcttgacgagttcttctg 3' 5' acgtctccgcatgtcagaag 3' 5' aaggcctgtccgatgtgaag 3' 5' ttcaggaagccaaacaccac 3' 5' GCTTGCCGTAGGTGGCATC 3' 5' CAGGAAACAGCTATGAC 3' | Backbone Marker:Connie Cepko (Addgene plasmid # 13769); Backbone Size:6107; Vector Backbone:pCALNL; Vector Types:Mammalian Expression, pCAGEN; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:20 | 0 | |
|
psiCHECK2-mMOV10-3'UTR-MRE16+MRE153-mut Resource Report Resource Website |
RRID:Addgene_178910 | 3'UTR mMov10 | Mus musculus | Ampicillin | PMID:35856394 | Please visit https://doi.org/10.1101/2021.11.09.467897 for bioRxiv preprint. | Backbone Marker:Promega; Backbone Size:3560; Vector Backbone:psiCHECK-2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | CTG>AGT and TGC>CAT mir16+153 mutated | 2026-08-15 01:24:20 | 0 |
|
pET28a Cdk2ap1CAN-MutTER Resource Report Resource Website |
RRID:Addgene_178033 | Cdk2ap1 | Mus musculus | Kanamycin | PMID:34644528 | Backbone Marker:EMD Biosciences; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression, Nonviral; Bacterial Resistance:Kanamycin | Changed T(108)A, E(109)A, R(110)A | 2026-08-15 01:24:20 | 0 | |
|
pLentiCRISPRv2-sgAAVS1-HepmTurquoise2 Resource Report Resource Website |
RRID:Addgene_192828 | mTurquoise2 | Mus musculus | Ampicillin | PMID:36643909 | Backbone Marker:Knouse Lab; Vector Backbone:pLentiCRISPRv2-Stuffer-HepmTurquoise2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:22 | 0 | ||
|
pSV40_mD6Ertd527e-HA-EGFP Resource Report Resource Website |
RRID:Addgene_192223 | mD6Ertd527e | Mus musculus | Ampicillin | PMID:36482406 | Backbone Size:2886; Vector Backbone:pSV40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:21 | 0 | ||
|
pMSCV Cdk2ap1ΔN (MT2B2)-HA Resource Report Resource Website |
RRID:Addgene_178031 | Cdk2ap1 | Mus musculus | Ampicillin | PMID:34644528 | Backbone Marker:David Bartel; Backbone Size:7657; Vector Backbone:pMSCV PIG (Puro IRES GFP empty vector); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | First N-Terminal 27aa are deleted | 2026-08-15 01:24:23 | 0 | |
|
Mouse Liver CRISPR Knockout Library Resource Report Resource Website |
RRID:Addgene_192824 | Mouse Liver CRISPR Knockout Library | Mus musculus | Ampicillin | PMID:36643909 | Vector Backbone:pLentiCRISPRv2-Stuffer-HepmCherry; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:26 | 0 | ||
|
AAV_pMBP-dnVamp2-P2AT2A-EGFP-caax Resource Report Resource Website |
RRID:Addgene_190153 | Vamp2 | Mus musculus | Ampicillin | PMID:36151203 | Uribina...& Gupton; PMID: 29351997 Gow...& Lazzarini; PMID:1383235 Pan... & Musacchio; PMID: 28059702. Please visit https://www.biorxiv.org/content/10.1101/2022.07.08.498895v1 for bioRxiv preprint. | Backbone Marker:Zuchero lab; Backbone Size:4561; Vector Backbone:pBZ-167 AAV CMV promoter base vector; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | Truncation that includes only AA #1-94 | 2026-08-15 01:24:25 | 0 |
|
pCMV-Vamp2-pHluorin Resource Report Resource Website |
RRID:Addgene_190151 | Vamp2 | Mus musculus | Ampicillin | PMID:36151203 | Vamp2-pHluorin was cloned from a construct kindly provided by Prof. Stephanie Gupton, from this paper: PMID: 29351997. Please visit https://www.biorxiv.org/content/10.1101/2022.07.08.498895v1 for bioRxiv preprint. | Backbone Marker:Zuchero lab; Vector Backbone:pBZ-167 AAV CMV promoter base vector; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:25 | 0 | |
|
SspBmicro-mCh-p60 Resource Report Resource Website 1+ mentions |
RRID:Addgene_190168 | SspBmicro-mCherry-p60 | Mus musculus | Ampicillin | PMID:36174574 | Backbone Marker:Lukas Kapitein lab; Backbone Size:6000; Vector Backbone:pB80; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:26 | 1 | ||
|
FAK Resource Report Resource Website |
RRID:Addgene_186141 | PTK2 | Mus musculus | Ampicillin | PMID:35049497 | Backbone Size:4856; Vector Backbone:pFastBac Htb; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:15 | 0 | ||
|
GFP-FAK W266A Resource Report Resource Website |
RRID:Addgene_186149 | PTK2 | Mus musculus | Kanamycin | PMID:35049497 | Backbone Size:4750; Vector Backbone:mEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:23:16 | 0 | ||
|
pFastBac FAK W266A Resource Report Resource Website |
RRID:Addgene_186144 | PTK2 | Mus musculus | Ampicillin | PMID:35049497 | Backbone Size:4856; Vector Backbone:pFastBac Htb; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | DNA mutation T796G;G797C Amino acid mutation W266A | 2026-08-15 01:23:15 | 0 | |
|
Lenti-sgArid1b#2/Cre Resource Report Resource Website |
RRID:Addgene_173574 | gRNA targeting Arid1b | Mus musculus | Ampicillin | PMID:33608386 | Please note there is a R24S mutation in Cre. Depositor confirms this does not affect plasmid function. | Vector Backbone:pLL3.3; Vector Types:Lentiviral, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:14 | 0 | |
|
LentiCRISPR-V2_mMSH2 Resource Report Resource Website |
RRID:Addgene_186156 | Msh2_gRNA | Mus musculus | Ampicillin | PMID:31303577 | Backbone Size:12992; Vector Backbone:LentiCRISPR V2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:17 | 0 | ||
|
pMSCV-IRES-GFP-Mouse-caspase-1/11a Resource Report Resource Website |
RRID:Addgene_183391 | CARD domain of mouse caspase-1 fused to catalytic domain of mouse caspase-11 | Mus musculus | Ampicillin | PMID:34734155 | Backbone Size:6400; Vector Backbone:pMSCV-IRES-EGFP; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:20 | 0 | ||
|
pCW57-mcGAS-LL/RK-NLS/D307A Resource Report Resource Website |
RRID:Addgene_185459 | cGAS | Mus musculus | Ampicillin | PMID:35538147 | Backbone Marker:Adam Karpf; Backbone Size:8185; Vector Backbone:pCW57-MCS1-P2A-MCS2 (Hygro); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | L157R, L159K, D307A | 2026-08-15 01:23:21 | 0 | |
|
pET28b_RanT24N Resource Report Resource Website |
RRID:Addgene_186271 | GTP-binding nuclear protein Ran | Mus musculus | Kanamycin | PMID:34424312 | For protein expression, transform into BL21(DE3) E. coli because the pET vector system requires T7 RNA polymerase for expression. Induce with 1 mM ITPG for 2h at 28 °C. | Backbone Size:5368; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Changed T24 into N | 2026-08-15 01:23:20 | 0 |
|
pET28b_RanWT Resource Report Resource Website |
RRID:Addgene_186270 | GTP-binding nuclear protein Ran | Mus musculus | Kanamycin | PMID:34424312 | For protein expression, transform into BL21(DE3) E. coli because the pET vector system requires T7 RNA polymerase for expression. Induce with 1 mM ITPG for 2h at 28 °C. | Backbone Size:5368; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:23:20 | 0 | |
|
pET28_mouse-Caspase-11_enzymatic-domain Resource Report Resource Website 1+ mentions |
RRID:Addgene_183382 | Caspase-11 (AA100-373) | Mus musculus | Kanamycin | PMID:34734155 | Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:23:20 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
