Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 179 showing 3561 ~ 3580 out of 12,959 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/191213

Species: Mus musculus
Genetic Insert: tdTomato-T2A-mSyp::EGFP
Vector Backbone Description: Backbone Marker:Connie Cepko (Addgene plasmid # 13769); Backbone Size:6107; Vector Backbone:pCALNL; Vector Types:Mammalian Expression, pCAGEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36386881
Comments: Suggested primers to sequence the insert: 5' ccttcttgacgagttcttctg 3' 5' acgtctccgcatgtcagaag 3' 5' aaggcctgtccgatgtgaag 3' 5' ttcaggaagccaaacaccac 3' 5' GCTTGCCGTAGGTGGCATC 3' 5' CAGGAAACAGCTATGAC 3'

Proper citation: RRID:Addgene_191213 Copy   


http://www.addgene.org/178910

Species: Mus musculus
Genetic Insert: 3'UTR mMov10
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3560; Vector Backbone:psiCHECK-2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35856394
Comments: Please visit https://doi.org/10.1101/2021.11.09.467897 for bioRxiv preprint.

Proper citation: RRID:Addgene_178910 Copy   


http://www.addgene.org/178033

Species: Mus musculus
Genetic Insert: Cdk2ap1
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression, Nonviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34644528

Proper citation: RRID:Addgene_178033 Copy   


http://www.addgene.org/192828

Species: Mus musculus
Genetic Insert: mTurquoise2
Vector Backbone Description: Backbone Marker:Knouse Lab; Vector Backbone:pLentiCRISPRv2-Stuffer-HepmTurquoise2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36643909

Proper citation: RRID:Addgene_192828 Copy   


http://www.addgene.org/192223

Species: Mus musculus
Genetic Insert: mD6Ertd527e
Vector Backbone Description: Backbone Size:2886; Vector Backbone:pSV40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36482406

Proper citation: RRID:Addgene_192223 Copy   


http://www.addgene.org/178031

Species: Mus musculus
Genetic Insert: Cdk2ap1
Vector Backbone Description: Backbone Marker:David Bartel; Backbone Size:7657; Vector Backbone:pMSCV PIG (Puro IRES GFP empty vector); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34644528

Proper citation: RRID:Addgene_178031 Copy   


http://www.addgene.org/192824

Species: Mus musculus
Genetic Insert: Mouse Liver CRISPR Knockout Library
Vector Backbone Description: Vector Backbone:pLentiCRISPRv2-Stuffer-HepmCherry; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36643909

Proper citation: RRID:Addgene_192824 Copy   


http://www.addgene.org/190153

Species: Mus musculus
Genetic Insert: Vamp2
Vector Backbone Description: Backbone Marker:Zuchero lab; Backbone Size:4561; Vector Backbone:pBZ-167 AAV CMV promoter base vector; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36151203
Comments: Uribina...& Gupton; PMID: 29351997 Gow...& Lazzarini; PMID:1383235 Pan... & Musacchio; PMID: 28059702. Please visit https://www.biorxiv.org/content/10.1101/2022.07.08.498895v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_190153 Copy   


  • RRID:Addgene_190151

http://www.addgene.org/190151

Species: Mus musculus
Genetic Insert: Vamp2
Vector Backbone Description: Backbone Marker:Zuchero lab; Vector Backbone:pBZ-167 AAV CMV promoter base vector; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36151203
Comments: Vamp2-pHluorin was cloned from a construct kindly provided by Prof. Stephanie Gupton, from this paper: PMID: 29351997. Please visit https://www.biorxiv.org/content/10.1101/2022.07.08.498895v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_190151 Copy   


  • RRID:Addgene_190168

    This resource has 1+ mentions.

http://www.addgene.org/190168

Species: Mus musculus
Genetic Insert: SspBmicro-mCherry-p60
Vector Backbone Description: Backbone Marker:Lukas Kapitein lab; Backbone Size:6000; Vector Backbone:pB80; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36174574

Proper citation: RRID:Addgene_190168 Copy   


  • RRID:Addgene_186141

http://www.addgene.org/186141

Species: Mus musculus
Genetic Insert: PTK2
Vector Backbone Description: Backbone Size:4856; Vector Backbone:pFastBac Htb; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35049497

Proper citation: RRID:Addgene_186141 Copy   


  • RRID:Addgene_186149

http://www.addgene.org/186149

Species: Mus musculus
Genetic Insert: PTK2
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35049497

Proper citation: RRID:Addgene_186149 Copy   


  • RRID:Addgene_186144

http://www.addgene.org/186144

Species: Mus musculus
Genetic Insert: PTK2
Vector Backbone Description: Backbone Size:4856; Vector Backbone:pFastBac Htb; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35049497

Proper citation: RRID:Addgene_186144 Copy   


  • RRID:Addgene_173574

http://www.addgene.org/173574

Species: Mus musculus
Genetic Insert: gRNA targeting Arid1b
Vector Backbone Description: Vector Backbone:pLL3.3; Vector Types:Lentiviral, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33608386
Comments: Please note there is a R24S mutation in Cre. Depositor confirms this does not affect plasmid function.

Proper citation: RRID:Addgene_173574 Copy   


  • RRID:Addgene_186156

http://www.addgene.org/186156

Species: Mus musculus
Genetic Insert: Msh2_gRNA
Vector Backbone Description: Backbone Size:12992; Vector Backbone:LentiCRISPR V2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31303577

Proper citation: RRID:Addgene_186156 Copy   


http://www.addgene.org/183391

Species: Mus musculus
Genetic Insert: CARD domain of mouse caspase-1 fused to catalytic domain of mouse caspase-11
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pMSCV-IRES-EGFP; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34734155

Proper citation: RRID:Addgene_183391 Copy   


http://www.addgene.org/185459

Species: Mus musculus
Genetic Insert: cGAS
Vector Backbone Description: Backbone Marker:Adam Karpf; Backbone Size:8185; Vector Backbone:pCW57-MCS1-P2A-MCS2 (Hygro); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35538147

Proper citation: RRID:Addgene_185459 Copy   


  • RRID:Addgene_186271

http://www.addgene.org/186271

Species: Mus musculus
Genetic Insert: GTP-binding nuclear protein Ran
Vector Backbone Description: Backbone Size:5368; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34424312
Comments: For protein expression, transform into BL21(DE3) E. coli because the pET vector system requires T7 RNA polymerase for expression. Induce with 1 mM ITPG for 2h at 28 °C.

Proper citation: RRID:Addgene_186271 Copy   


  • RRID:Addgene_186270

http://www.addgene.org/186270

Species: Mus musculus
Genetic Insert: GTP-binding nuclear protein Ran
Vector Backbone Description: Backbone Size:5368; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34424312
Comments: For protein expression, transform into BL21(DE3) E. coli because the pET vector system requires T7 RNA polymerase for expression. Induce with 1 mM ITPG for 2h at 28 °C.

Proper citation: RRID:Addgene_186270 Copy   


http://www.addgene.org/183382

Species: Mus musculus
Genetic Insert: Caspase-11 (AA100-373)
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34734155

Proper citation: RRID:Addgene_183382 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X