Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pICE-HA-NLS-I-PpoI Resource Report Resource Website 1+ mentions |
RRID:Addgene_46963 | NLS-I-PpoI | Physarum polycephalum | Ampicillin | PMID:23897892 | Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:37 | 3 | ||
|
pEGFP-C1-FLAG Resource Report Resource Website 1+ mentions |
RRID:Addgene_46956 | FLAG tag | Synthetic | Kanamycin | PMID:23897892 | Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:37 | 9 | ||
|
pEGFP-C1-FLAG-Ku70 Resource Report Resource Website 10+ mentions |
RRID:Addgene_46957 | Ku70 | Homo sapiens | Kanamycin | PMID:23897892 | Backbone Size:4766; Vector Backbone:pEGFP-C1-FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:36 | 13 | ||
|
p52sheLL Resource Report Resource Website 1+ mentions |
RRID:Addgene_46950 | HPV52L1+L2 | Homo sapiens | Ampicillin | PMID:18360909 | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 2 | ||
|
pINDUCER21 (ORF-EG) Resource Report Resource Website 10+ mentions |
RRID:Addgene_46948 | Chloramphenicol and Ampicillin | PMID:21307310 | Backbone Marker:Dr. Richard Mulligan; Backbone Size:4874; Vector Backbone:pHAGE-CAGS-W; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:15:36 | 33 | ||||
|
pCIneoEGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_46949 | GFP | Aequorea victoria | Ampicillin | PMID:18228512 | Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCIneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:37 | 5 | ||
|
pIRES-Ap2a2-FKBP Resource Report Resource Website 1+ mentions |
RRID:Addgene_46944 | Ap2a2-FKBP | Homo sapiens | Ampicillin | PMID:20159602 | Backbone Marker:Clontech; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 1 | ||
|
pEYFP-Mitotrap Resource Report Resource Website 1+ mentions |
RRID:Addgene_46942 | Mitotrap | Homo sapiens | Kanamycin | PMID:20159602 | Backbone Marker:Clontech; Vector Backbone:pEYFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:36 | 4 | ||
|
pcDNA-f:PGC1-3D Resource Report Resource Website 1+ mentions |
RRID:Addgene_47 | PGC-1a | Mus musculus | Ampicillin | PMID:14744933 | Please see Addgene plasmid 1026 (pcDNA-f:PGC1) for wildtype sequence and map. | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1 myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Amino acids 262, 265, and 298 have been changed to aspartic acid | 2026-08-15 01:15:37 | 6 |
|
5HRE/GFP Resource Report Resource Website 10+ mentions |
RRID:Addgene_46926 | 5X HRE of VEGF | Homo sapiens | Ampicillin | PMID:11774035 | The 35-bp human VEGF HRE sequence is: CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT The d2EGFP fragment was amplified from a Clontech (Palo Alto, CA) vector and encodes a destabilized red- shifted variant of wild-type GFP with an excitation maximum of 488 nm, an emission maximum of 507 nm, and a half-life of approximately 2 hours. | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pEF/myc/cyto; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | five copies of a 35-bp fragment from the hypoxia-responsive element (HRE) of the human VEGF gene and a human cytomegalovirus minimal promoter | 2026-08-15 01:15:37 | 24 |
|
YFP-Parkin C431N Resource Report Resource Website 1+ mentions |
RRID:Addgene_46924 | Park2 | Homo sapiens | Kanamycin | PMID:23319602 | Backbone Marker:Clontech; Backbone Size:4698; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | changed cysteine 431 to asparagine | 2026-08-15 01:15:36 | 2 | |
|
LZRSMS-GFP-hFJX1-Flag Resource Report Resource Website 1+ mentions |
RRID:Addgene_46929 | FJX1 | Homo sapiens | Ampicillin | Backbone Size:12800; Vector Backbone:LZRS-MS-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 1 | |||
|
pMA3288 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46885 | Uracil-N-glycosylase WT | Homo sapiens | Ampicillin | PMID:23721969 | Backbone Marker:Homemade; Backbone Size:6686; Vector Backbone:pMA2780; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 1 | ||
|
pMSP3535 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46886 | Erythromycin | PMID:10964628 | This plasmid utilizes the NIsin Controlled Expression (NICE) system. NICE® is a registered trademark of NIZO food research BV, P.O.Box 20, 6710 BA Ede, The Netherlands. pMSP3535 contains the Nisin-inducible PnisA promoter, and the pAMB1 replicon for expression in gram-positive bacteria. For protein expression in E. faecalis, induce with 10-25 ng/mL nisin (Sigma, N-5764). See associated article for instructions on how to make nisin solution. Note: Nucleotide sequence encoding the signal sequence and one-third of the mature NisA (nisin) peptide remains associated with the PnisA promoter. The depositing laboratory recommends adding of a Stop codon to the 5' end of inserted sequences to avoid unintentional gene fusions. Addgene's quality control sequencing finds discrepancies with the depositor's provided sequencew which includes a mutation in RepE- F229L. This however is thought to not affect plasmid function. | Backbone Size:8353; Vector Backbone:pMSP3535; Vector Types:Bacterial Expression, Nisin-inducible expression; Gram-positive Bacterial Shuttle Vector; Bacterial Resistance:Erythromycin | 2026-08-15 01:15:36 | 6 | |||
|
pMSP3535VA Resource Report Resource Website 1+ mentions |
RRID:Addgene_46887 | Kanamycin | PMID:10964628 | This plasmid utilizes the NIsin Controlled Expression (NICE) system. NICE® is a registered trademark of NIZO food research BV, P.O.Box 20, 6710 BA Ede, The Netherlands. pMSP3535VA contains the Nisin-inducible PnisA promoter, and the pVA380-1 replicon for expression in gram-positive bacteria. For protein expression in E. faecalis, induce with 10-25 ng/mL nisin (Sigma, N-5764). See associated article for instructions on how to make nisin solution. Note: Nucleotide sequence encoding the signal sequence and one-third of the mature NisA (nisin) peptide remains associated with the PnisA promoter. The depositing laboratory recommends adding of a Stop codon to the 5' end of inserted sequences to avoid unintentional gene fusions. Note: The theoretical full sequence uploaded here is NOT fully accurate - the NheI site at position 4414 has been lost, along with approximately 500bp of sequence in this region (compare the depositor's uploaded maps). The actual size of this plasmid is 8278 as listed here. The depositing lab has not resequenced the region in question, but the discrepancy does not affect plasmid function. Note: This plasmid has been shown to accumulate deletions when replicated in E. coli (or gram-negative bacteria). Screening transformants by restriction digest is recommended. Addgene's quality control sequencing finds discrepancies with the depositor's provided sequence, but they are not thought to affect plasmid function. | Backbone Size:8278; Vector Backbone:pMSP3535VA; Vector Types:Bacterial Expression, Nisin-inducible expression; Gram-positive Bacterial Shuttle Vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:36 | 1 | |||
|
pTDH3-dCas9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46920 | dCas9 | Ampicillin | PMID:23849981 | The Cas9 contains a N612K mutation that does not effect the function of the enzyme. | Backbone Size:6900; Vector Backbone:pJED103; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 7 | ||
|
pU6-sgGFP-NT1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46914 | sgGFP-NT1 | Ampicillin | PMID:23849981 | gRNA target sequence GAATAGCTCAGAGGCCGAGG | Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 8 | ||
|
pU6-sgGAL4-1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46915 | sgGAL4-1 | Ampicillin | PMID:23849981 | gRNA target sequence GTTGGAGCACTGTCCTCCGAACGT | Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 2 | ||
|
pMA3211 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46879 | Ampicillin | PMID:22637478 | Backbone Marker:Homemade; Backbone Size:6642; Vector Backbone:pMA3211; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 1 | ||||
|
pMSCV-LTR-dCas9-p65AD-BFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_46913 | dCas9-p65AD-BFP fusion | Homo sapiens | Ampicillin | PMID:23849981 | Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:MSCV-puro; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:37 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
