Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Stratagene; Vector Backbone:pBluescript; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24116091
Proper citation: RRID:Addgene_49297 Copy
Vector Backbone Description: Backbone Marker:Stratagene; Vector Backbone:pBluescript; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24116091
Proper citation: RRID:Addgene_49295 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Dr. James Sutherland ; Backbone Size:6600; Vector Backbone:pAc-STABLE1-Puro; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24326186
Comments: gRNA target sequence GGTTTTGGACACTGGAACCG
Proper citation: RRID:Addgene_49331 Copy
Species: Synthetic
Genetic Insert: GBP7-p65 transactivation domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.
Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Proper citation: RRID:Addgene_49441 Copy
Species: Synthetic
Genetic Insert: GPD-roGFP2
Vector Backbone Description: Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20019331
Proper citation: RRID:Addgene_49436 Copy
Species: Synthetic
Genetic Insert: roGFP2
Vector Backbone Description: Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20019331
Proper citation: RRID:Addgene_49435 Copy
Species: Synthetic
Genetic Insert: GBP2-Gal4 DNA binding domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.
Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Proper citation: RRID:Addgene_49439 Copy
Species: Synthetic
Genetic Insert: GBP1-Gal4 DNA binding domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: The GBP1 used differs from the PDB GBP1 by two amino acids. One is Q3D at a site away from the GFP binding pocket and not expected to affect GFP binding. The second was a C98S mutation to enhance protein solubility.
Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.
Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Proper citation: RRID:Addgene_49438 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: autophagy-related 8
Vector Backbone Description: Backbone Size:4898; Vector Backbone:pRS416; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11739783
Proper citation: RRID:Addgene_49425 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: autophagy-related 8
Vector Backbone Description: Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12589048
Proper citation: RRID:Addgene_49424 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: autophagy-related 8
Vector Backbone Description: Backbone Size:4898; Vector Backbone:pRS416; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22977244
Proper citation: RRID:Addgene_49423 Copy
Species: Homo sapiens
Genetic Insert: AF-9
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5100; Vector Backbone:pcDNA5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21729782
Proper citation: RRID:Addgene_49428 Copy
Genetic Insert: PTEN
Vector Backbone Description: Backbone Marker:DNA2.0; Backbone Size:3968; Vector Backbone:JpExpress404; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23744781
Proper citation: RRID:Addgene_49420 Copy
Species: Other
Genetic Insert: Twitch-4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24390440
Proper citation: RRID:Addgene_49533 Copy
Species: Homo sapiens
Genetic Insert: GSK3beta S9A
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23085750
Proper citation: RRID:Addgene_49492 Copy
Species: Drosophila melanogaster
Genetic Insert: dU6-1:gRNA
Vector Backbone Description: Backbone Marker:Norbert Perrimon, Jian-Quan Ni, Harvard; Vector Backbone:pValium22; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25002478
Comments: Please acknowledge Fillip Port and Simon Bullock when publishing work derived from use of this plasmid.
Visit crisprflydesign.org for more information.
Proper citation: RRID:Addgene_49411 Copy
Species: Opsanus tau
Genetic Insert: Twitch-2B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24390440
Comments: There is a discrepancy in the publication, Plasmid 48203: Twitch-2B pRSETB and Plasmid 49531: Twitch-2B pcDNA3 are misidentified.
Proper citation: RRID:Addgene_49531 Copy
Species: Mus musculus
Genetic Insert: BMPR-1B DN
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2959; Vector Backbone:pBluescript SK+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9303535
Comments: The BMPR-1B insert in this plasmid contains a L2V mutation when compared to GenBank reference sequence NP_031586.1. This mutation is not a concern for the function of the plasmid, as described in the associated publication.
Proper citation: RRID:Addgene_49530 Copy
Genetic Insert: P750
Vector Backbone Description: Backbone Size:2597; Vector Backbone:pDO12A; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24191058
Proper citation: RRID:Addgene_49525 Copy
Species: Homo sapiens
Genetic Insert: KFL6-4A
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23085750
Proper citation: RRID:Addgene_49489 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.