Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 180 showing 3581 ~ 3600 out of 328,630 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_49297

http://www.addgene.org/49297

Vector Backbone Description: Backbone Marker:Stratagene; Vector Backbone:pBluescript; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24116091

Proper citation: RRID:Addgene_49297 Copy   


  • RRID:Addgene_49295

http://www.addgene.org/49295

Vector Backbone Description: Backbone Marker:Stratagene; Vector Backbone:pBluescript; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24116091

Proper citation: RRID:Addgene_49295 Copy   


  • RRID:Addgene_49331

    This resource has 1+ mentions.

http://www.addgene.org/49331

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Dr. James Sutherland ; Backbone Size:6600; Vector Backbone:pAc-STABLE1-Puro; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24326186
Comments: gRNA target sequence GGTTTTGGACACTGGAACCG

Proper citation: RRID:Addgene_49331 Copy   


  • RRID:Addgene_49441

    This resource has 1+ mentions.

http://www.addgene.org/49441

Species: Synthetic
Genetic Insert: GBP7-p65 transactivation domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138. Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.

Proper citation: RRID:Addgene_49441 Copy   


  • RRID:Addgene_49436

    This resource has 1+ mentions.

http://www.addgene.org/49436

Species: Synthetic
Genetic Insert: GPD-roGFP2
Vector Backbone Description: Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20019331

Proper citation: RRID:Addgene_49436 Copy   


  • RRID:Addgene_49435

    This resource has 10+ mentions.

http://www.addgene.org/49435

Species: Synthetic
Genetic Insert: roGFP2
Vector Backbone Description: Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20019331

Proper citation: RRID:Addgene_49435 Copy   


  • RRID:Addgene_49439

    This resource has 1+ mentions.

http://www.addgene.org/49439

Species: Synthetic
Genetic Insert: GBP2-Gal4 DNA binding domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138. Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.

Proper citation: RRID:Addgene_49439 Copy   


  • RRID:Addgene_49438

    This resource has 1+ mentions.

http://www.addgene.org/49438

Species: Synthetic
Genetic Insert: GBP1-Gal4 DNA binding domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: The GBP1 used differs from the PDB GBP1 by two amino acids. One is Q3D at a site away from the GFP binding pocket and not expected to affect GFP binding. The second was a C98S mutation to enhance protein solubility. Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138. Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.

Proper citation: RRID:Addgene_49438 Copy   


  • RRID:Addgene_49425

    This resource has 1+ mentions.

http://www.addgene.org/49425

Species: Saccharomyces cerevisiae
Genetic Insert: autophagy-related 8
Vector Backbone Description: Backbone Size:4898; Vector Backbone:pRS416; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11739783

Proper citation: RRID:Addgene_49425 Copy   


  • RRID:Addgene_49424

    This resource has 1+ mentions.

http://www.addgene.org/49424

Species: Saccharomyces cerevisiae
Genetic Insert: autophagy-related 8
Vector Backbone Description: Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12589048

Proper citation: RRID:Addgene_49424 Copy   


  • RRID:Addgene_49423

    This resource has 1+ mentions.

http://www.addgene.org/49423

Species: Saccharomyces cerevisiae
Genetic Insert: autophagy-related 8
Vector Backbone Description: Backbone Size:4898; Vector Backbone:pRS416; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22977244

Proper citation: RRID:Addgene_49423 Copy   


  • RRID:Addgene_49428

    This resource has 1+ mentions.

http://www.addgene.org/49428

Species: Homo sapiens
Genetic Insert: AF-9
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5100; Vector Backbone:pcDNA5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21729782

Proper citation: RRID:Addgene_49428 Copy   


  • RRID:Addgene_49420

    This resource has 1+ mentions.

http://www.addgene.org/49420

Genetic Insert: PTEN
Vector Backbone Description: Backbone Marker:DNA2.0; Backbone Size:3968; Vector Backbone:JpExpress404; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23744781

Proper citation: RRID:Addgene_49420 Copy   


  • RRID:Addgene_49533

    This resource has 1+ mentions.

http://www.addgene.org/49533

Species: Other
Genetic Insert: Twitch-4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24390440

Proper citation: RRID:Addgene_49533 Copy   


  • RRID:Addgene_49492

    This resource has 1+ mentions.

http://www.addgene.org/49492

Species: Homo sapiens
Genetic Insert: GSK3beta S9A
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23085750

Proper citation: RRID:Addgene_49492 Copy   


  • RRID:Addgene_49411

    This resource has 100+ mentions.

http://www.addgene.org/49411

Species: Drosophila melanogaster
Genetic Insert: dU6-1:gRNA
Vector Backbone Description: Backbone Marker:Norbert Perrimon, Jian-Quan Ni, Harvard; Vector Backbone:pValium22; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25002478
Comments: Please acknowledge Fillip Port and Simon Bullock when publishing work derived from use of this plasmid. Visit crisprflydesign.org for more information.

Proper citation: RRID:Addgene_49411 Copy   


  • RRID:Addgene_49531

    This resource has 10+ mentions.

http://www.addgene.org/49531

Species: Opsanus tau
Genetic Insert: Twitch-2B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24390440
Comments: There is a discrepancy in the publication, Plasmid 48203: Twitch-2B pRSETB and Plasmid 49531: Twitch-2B pcDNA3 are misidentified.

Proper citation: RRID:Addgene_49531 Copy   


  • RRID:Addgene_49530

    This resource has 1+ mentions.

http://www.addgene.org/49530

Species: Mus musculus
Genetic Insert: BMPR-1B DN
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2959; Vector Backbone:pBluescript SK+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9303535
Comments: The BMPR-1B insert in this plasmid contains a L2V mutation when compared to GenBank reference sequence NP_031586.1. This mutation is not a concern for the function of the plasmid, as described in the associated publication.

Proper citation: RRID:Addgene_49530 Copy   


  • RRID:Addgene_49525

http://www.addgene.org/49525

Genetic Insert: P750
Vector Backbone Description: Backbone Size:2597; Vector Backbone:pDO12A; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24191058

Proper citation: RRID:Addgene_49525 Copy   


  • RRID:Addgene_49489

http://www.addgene.org/49489

Species: Homo sapiens
Genetic Insert: KFL6-4A
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23085750

Proper citation: RRID:Addgene_49489 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X