Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: Promotor probe
Vector Backbone Description: Vector Backbone:pBBR1; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11059491
Comments: This plasmid has the PstI site.
Please note that there is a T=>C mutation, causing LVA=>LAA change in aa.
Proper citation: RRID:Addgene_40170 Copy
Species: Homo sapiens
Genetic Insert: erbB1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17956594
Proper citation: RRID:Addgene_40267 Copy
Species: Homo sapiens
Genetic Insert: erbB1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEYFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17956594
Proper citation: RRID:Addgene_40266 Copy
Species: Homo sapiens
Genetic Insert: HTT partial exon 1 Q23
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10528852
Proper citation: RRID:Addgene_40261 Copy
Species: Anabaena sp. Strain PCC 7120
Genetic Insert: GFPmut2
Vector Backbone Description: Vector Backbone:pAM505; Vector Types:Cyanobacteria cloning vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9794762
Comments: Contain promoterless gfp from pKEN2-GFPmut2 inserted into pAM505.
HindIII-Klenow fill-SacI fragment of gfp is inserted into SmaI-SacI digested pAM505. This is a control of gfp without a promoter. The multiple cloning site upstream the gfp gene includes: SalI, SacI, KpnI,Asp718, XmaI, and SmaI.
Proper citation: RRID:Addgene_40251 Copy
Species: Rattus norvegicus
Genetic Insert: GCaMP6s
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3955; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23868258
Proper citation: RRID:Addgene_40753 Copy
Species: Homo sapiens
Genetic Insert: PLXNA4A
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/4E74/
Proper citation: RRID:Addgene_40748 Copy
Species: Synthetic
Genetic Insert: Leucine Zipper prime - C super positive Green Fluorescent Protein
Vector Backbone Description: Backbone Size:4496; Vector Backbone:pMRBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22692102
Proper citation: RRID:Addgene_40730 Copy
Species: Homo sapiens
Genetic Insert: L3MBTL3
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC-CH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/4FL6/
Proper citation: RRID:Addgene_40738 Copy
Species: Mus musculus
Genetic Insert: AMPK-γ1
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pCMV-Tag4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17012231
Comments: AMPK-γ1 insert has Kozak sequence embedded at 5'-terminus and a stop codon at the 3'-terminus. The FLAG of the pCMV-Tag4a backbone is out of frame.
Proper citation: RRID:Addgene_40605 Copy
Species: Mus musculus
Genetic Insert: AMPK-β2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17012231
Proper citation: RRID:Addgene_40603 Copy
Species: Mus musculus
Genetic Insert: AMPK-β1
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pCMV-Tag4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17012231
Proper citation: RRID:Addgene_40602 Copy
Species: Mus musculus
Genetic Insert: AMPK-β2
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pCMV-Tag5a; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17012231
Comments: Does not express well. Minimal kozak only GCCATGGG.
Proper citation: RRID:Addgene_40606 Copy
Species: Drosophila melanogaster
Genetic Insert: let-7–mm14-21
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 mm14-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGATAGTCCGTACCTACTACCTCAT
as: CTAGATGAGGTAGTAGGTACGGACTAT
Proper citation: RRID:Addgene_40851 Copy
Species: Drosophila melanogaster
Genetic Insert: let-7–mm15-21
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 mm15-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGATAACCCGAACCTACTACCTCAT
as: CTAGATGAGGTAGTAGGTTCGGGTTAT
Proper citation: RRID:Addgene_40850 Copy
Species: Drosophila melanogaster
Genetic Insert: let-7–mm1-8
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 mm1-8 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGAACTATACAACCTAGATGGAGTT
as: CTAGAACTCCATCTAGGTTGTATAGTT
Proper citation: RRID:Addgene_40847 Copy
Species: Drosophila melanogaster
Genetic Insert: let-7–bulge9-15
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 bulge9-15 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGAACTATAGTTGGATCTACCTCAT
as: CTAGATGAGGTAGATCCAACTATAGTT
Proper citation: RRID:Addgene_40846 Copy
Species: Drosophila melanogaster
Genetic Insert: let-7–bulge 9-13
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 bulge 9-13 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGAACTATACATGGATCTACCTCAT
as: CTAGATGAGGTAGATCCATGTATAGTT
Proper citation: RRID:Addgene_40845 Copy
Species: Drosophila melanogaster
Genetic Insert: let-7–seed1-8
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 seed1-8 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGATAACACGTTGGCTCTACCTCAT
as: CTAGATGAGGTAGAGCCAACGTGTTAT
Proper citation: RRID:Addgene_40843 Copy
Species: Drosophila melanogaster
Genetic Insert: let-7–mm16-21
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 mm16-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGATGACACCAACCTACTACCTCAT
as: CTAGATGAGGTAGTAGGTTGGTGTCAT
Proper citation: RRID:Addgene_40849 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.