Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 181 showing 3601 ~ 3620 out of 177,820 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/40338

Species: Homo sapiens
Genetic Insert: BCL-6Δ
Vector Backbone Description: Backbone Marker:Masafumi Tanaka and Winship Herr (PMID: 2302733); Backbone Size:7500; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10973278
Comments: The expression plasmid pCGN-BCL-6Δ was constructed by digesting the BCL-6 cDNA with EcoRI, deleting the 3' region, and cloning the remaining cDNA into pCGN. The BCL-6Δ is missing four of six zinc fingers and does not bind to a consensus BCL-6 probe in a gel shift assay (A. L. Dent, unpublished data). Note, the cloning and ligation adds the following residues after aa595 of BCL6: RYQAYRYRRPGYR

Proper citation: RRID:Addgene_40338 Copy   


  • RRID:Addgene_40292

    This resource has 1+ mentions.

http://www.addgene.org/40292

Species: Homo sapiens
Genetic Insert: Pumilio homolog 2
Vector Backbone Description: Backbone Size:5372; Vector Backbone:pFRT/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20371350
Comments: Note that there are some cloning scars flanking the insert (see Addgene sequence), but they will not affect plasmid function.

Proper citation: RRID:Addgene_40292 Copy   


  • RRID:Addgene_40290

    This resource has 1+ mentions.

http://www.addgene.org/40290

Species: Homo sapiens
Genetic Insert: Calnexin
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23656278
Comments: Addgene sequencing results find I474N in calnexin translation compared to reference sequence NP_001737.1

Proper citation: RRID:Addgene_40290 Copy   


http://www.addgene.org/40325

Species: Mus musculus
Genetic Insert: MCP-1 promoter (mutated)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10973278
Comments: Note: Addgene NGS results identified an extra ~500 bp region upstream of the expected promoter, which contains a CMV enhancer feature. It is unknown what impact the region may have on plasmid function, but the extra sequence appears to have been present in the original sample received by Addgene. A plasmid containing the mouse MCP-1 promoter driving luciferase (pMCP-Luc) was constructed from pGL3-basic (Promega, Madison, WI) and a PCR-generated MCP-1 promoter fragment. A proofreading competent Taq reagent (AccuTaq, Sigma) was used to ensure high fidelity PCR. 1.2 kb of the MCP-1 promoter (GenBank Accession no. U12470) was obtained by PCR of C57BL/6 mouse DNA with the following primers: 5′–TCATGTATATGGCTTTCCAGGTCT–3′ (sense strand, distal to transcription start) 5′–TGCACTTCTGGCTGCTCTGAG GCA–3′ (antisense strand, proximal to transcription start) The PCR product terminates 28-bp downstream of the MCP-1 TATA site. XmaI and XhoI sites were added to the MCP-1 promoter by a second round of PCR with the primers: 5′–ATATCACCCGGGTCATGTATATGGCTTTCCAGGTCT–3′ 5′–TAGATTCTCGAGTGCACTTCTGGCTGCTCTGAGGCA–3′ and XmaI and XhoI were used to clone the MCP-1 promoter fragment into pGL3-basic. For the construction of the MCP-1 mutant promoter, the BCL-6 site was mutated by a two step PCR–based strategy using the above flanking primers and the following complementary primers to mutate the BCL-6 site: 5′–TCTCTCTTCCACTTCCT[TT]AAACA–3′ 5′–TGTTT[AA]AGGAAGTGGAAGAGAGA–3′ (mutated bases are in brackets) The mutant promoter was cloned into pGL3 via XhoI and XmaI. The wild-type and mutant MCP-1 promoter sequences were verified by sequencing.

Proper citation: RRID:Addgene_40325 Copy   


  • RRID:Addgene_40281

    This resource has 10+ mentions.

http://www.addgene.org/40281

Species: Mus musculus
Genetic Insert: 2C Promoter (2-cell stage promoter)
Vector Backbone Description: Backbone Marker:Invitrogen/Life Tech; Backbone Size:6400; Vector Backbone:pcDNA Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22722858
Comments: The CMV promoter from the parent pcDNA plasmid was removed with MluI and HindIII, leaving approx. 6400kb backbone. The 2C promoter was put in its place (730bp) using the same sites. Hence, the full plasmid is 7129bp. The promoter is active shortly after fertilization of mouse embryos to about the 8-cell stage. It is also on in a subset of MESCs & miPSCs.

Proper citation: RRID:Addgene_40281 Copy   


  • RRID:Addgene_40289

http://www.addgene.org/40289

Species: Synthetic
Genetic Insert: ddYFP-B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4100; Vector Backbone:pBad-modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23656278

Proper citation: RRID:Addgene_40289 Copy   


  • RRID:Addgene_40322

    This resource has 1+ mentions.

http://www.addgene.org/40322

Vector Backbone Description: Backbone Size:6447; Vector Backbone:JDS94; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Backbone contains NNN/G 0.5 Domain TAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: ELD (-) heterodimer (Doyon et al. 2011)

Proper citation: RRID:Addgene_40322 Copy   


  • RRID:Addgene_40321

    This resource has 1+ mentions.

http://www.addgene.org/40321

Vector Backbone Description: Backbone Size:6447; Vector Backbone:JDS92; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Backbone contains SHD/C 0.5 Domain TAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: ELD (-) heterodimer (Doyon et al. 2011)

Proper citation: RRID:Addgene_40321 Copy   


  • RRID:Addgene_40287

    This resource has 1+ mentions.

http://www.addgene.org/40287

Species: Synthetic
Genetic Insert: ddGFP-B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4100; Vector Backbone:pBad-modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23656278

Proper citation: RRID:Addgene_40287 Copy   


  • RRID:Addgene_40320

    This resource has 1+ mentions.

http://www.addgene.org/40320

Vector Backbone Description: Backbone Size:6447; Vector Backbone:JDS90; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Backbone contains SNI/A 0.5 Domain TAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: ELD (-) heterodimer (Doyon et al. 2011)

Proper citation: RRID:Addgene_40320 Copy   


  • RRID:Addgene_40283

    This resource has 1+ mentions.

http://www.addgene.org/40283

Genetic Insert: NaChBac
Vector Backbone Description: Backbone Size:8914; Vector Backbone:pUAST; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16407556

Proper citation: RRID:Addgene_40283 Copy   


  • RRID:Addgene_40282

http://www.addgene.org/40282

Species: Bacillus halodurans
Genetic Insert: NaChBac-EGFP
Vector Backbone Description: Backbone Size:8914; Vector Backbone:pUAST; Vector Types:Drosophila; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16407556

Proper citation: RRID:Addgene_40282 Copy   


  • RRID:Addgene_40319

    This resource has 1+ mentions.

http://www.addgene.org/40319

Vector Backbone Description: Backbone Size:6447; Vector Backbone:JDS88; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Backbone contains SNG/T 0.5 Domain TAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: KKR (+) heterodimer (Doyon et al. 2011)

Proper citation: RRID:Addgene_40319 Copy   


  • RRID:Addgene_40316

    This resource has 1+ mentions.

http://www.addgene.org/40316

Vector Backbone Description: Backbone Size:6447; Vector Backbone:JDS80; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Backbone contains SNI/A 0.5 Domain TAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: KKR (+) heterodimer (Doyon et al. 2011)

Proper citation: RRID:Addgene_40316 Copy   


  • RRID:Addgene_40276

    This resource has 1+ mentions.

http://www.addgene.org/40276

Species: Saccharomyces cerevisiae
Genetic Insert: LEU2
Vector Backbone Description: Backbone Marker:ATCC, Number: 77142; Backbone Size:4967; Vector Backbone:pRS313; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23222782

Proper citation: RRID:Addgene_40276 Copy   


  • RRID:Addgene_40267

    This resource has 1+ mentions.

http://www.addgene.org/40267

Species: Homo sapiens
Genetic Insert: erbB1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17956594

Proper citation: RRID:Addgene_40267 Copy   


  • RRID:Addgene_40266

    This resource has 1+ mentions.

http://www.addgene.org/40266

Species: Homo sapiens
Genetic Insert: erbB1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEYFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17956594

Proper citation: RRID:Addgene_40266 Copy   


  • RRID:Addgene_40263

    This resource has 1+ mentions.

http://www.addgene.org/40263

Species: Homo sapiens
Genetic Insert: HTT partial exon 1 Q23
Vector Backbone Description: Backbone Marker:Roche; Backbone Size:5450; Vector Backbone:pHM6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10528852

Proper citation: RRID:Addgene_40263 Copy   


http://www.addgene.org/40384

Species: Homo sapiens
Genetic Insert: LRRK2
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pBACgus; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_40384 Copy   


http://www.addgene.org/40383

Species: Homo sapiens
Genetic Insert: LRRK2
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pBACgus; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_40383 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X