Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Drosophila melanogaster
Genetic Insert: let-7–Bartel
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 Bartel complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGATGATAACAACGATCTACCTCAT
as: CTAGATGAGGTAGATCGTTGTTATCAT
Proper citation: RRID:Addgene_40848 Copy
Species: Drosophila melanogaster
Genetic Insert: let-7–mm19-21
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7–mm19-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGATGAATACAACCTACTACCTCAT
as: CTAGATGAGGTAGTAGGTTGTATTCAT
Proper citation: RRID:Addgene_40839 Copy
Species: Drosophila melanogaster
Genetic Insert: let-7–mm21
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 mm21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGATCTATACAACCTACTACCTCAT
as: CTAGATGAGGTAGTAGGTTGTATAGAT
Proper citation: RRID:Addgene_40837 Copy
Species: Homo sapiens
Genetic Insert: SNCA
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10698681
Comments: Please note that EcoRI is not a unique site. The alpha-synuclein insert contains an EcoRI site in the coding sequence.
Proper citation: RRID:Addgene_40822 Copy
Species: Xanthamonas oryzae
Genetic Insert: Transcription Activator Like Effector Nuclease
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:3890; Vector Backbone:pET-28b; Vector Types:Bacterial Expression, TALEN; Bacterial Resistance:Kanamycin
Comments: Please acknowledge the principal investigator, Dr. Gang Bao, and include this article in your citations if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 40787" in your Materials and Methods section.
Proper citation: RRID:Addgene_40787 Copy
Species: Mus musculus
Genetic Insert: Arl13b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2601; Vector Backbone:pENTR/SD/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21976698
Proper citation: RRID:Addgene_40870 Copy
Species: Homo sapiens
Genetic Insert: cdc25C5
Vector Backbone Description: Backbone Marker:Jonathan Pines Lab (Gurdon Institute, University of Cambridge, UK); Vector Backbone:pT7-Venus-C1 (785); Vector Types:In Vitro Transcription; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_40968 Copy
Species: Bos taurus
Genetic Insert: supervillin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10362542
Proper citation: RRID:Addgene_40963 Copy
Genetic Insert: PM-FRB-mRFP-T2A-FKBP-5-ptase
Vector Backbone Description: Vector Backbone:pmRFP-C1; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22357943
Proper citation: RRID:Addgene_40896 Copy
Species: Homo sapiens
Genetic Insert: Cep164
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4110; Vector Backbone:pCJW206 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17954613
Comments: PCR was used to amplify a full-length human Cep164 cDNA from clone KIAA1052 (Kazusa DNA Research Institute). The cDNA was subcloned into a mammalian expression vector providing a myc epitope tag and the construct was verified by sequencing.
Proper citation: RRID:Addgene_41148 Copy
Vector Backbone Description: Backbone Marker:Merck; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_41141 Copy
Vector Backbone Description: Backbone Marker:Merck; Vector Backbone:pRSRDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_41131 Copy
Vector Backbone Description: Backbone Marker:Merck; Vector Backbone:pRSRDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_41128 Copy
Species: Homo sapiens
Genetic Insert: MHC IIA
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17567956
Proper citation: RRID:Addgene_35687 Copy
Species: Homo sapiens
Genetic Insert: MHC IIA
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18971378
Proper citation: RRID:Addgene_35689 Copy
Species: SV40
Genetic Insert: loxP-STOP-loxP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Kanamycin
Comments: If you are using the cassette for gene targeting, you should check the number of SV40 repeats in the targeted locus as the lab has noticed that in some ES clones copies of the repeats were missing.
Please also see Lox-Stop-Lox TOPO (http://www.addgene.org/11584/) for a puromycin version of this plasmid and to download a document about using the Lox-Stop-Lox system.
Proper citation: RRID:Addgene_35688 Copy
Species: Homo sapiens
Genetic Insert: MRLC1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22136066
Comments: This plasmid is identical to the one published in Beach et al., 2011, except the tet-inducible promoter has been replaced with a constitutive CMV promoter.
Proper citation: RRID:Addgene_35681 Copy
Species: Homo sapiens
Genetic Insert: MRLC1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22136066
Comments: This plasmid is identical to the one published in Beach et al., 2011, except the tet-inducible promoter has been replaced with a constitutive CMV promoter.
Proper citation: RRID:Addgene_35680 Copy
Species: Danio rerio
Genetic Insert: Pcdh19
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21115806
Proper citation: RRID:Addgene_35675 Copy
Species: Mus musculus
Genetic Insert: Synectin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16908842
Comments: This construct contains a K111R mutation when compared to GenBank ID NP_061241.1 This mutation is most likely a sequence conflict, one of several (see Uniprot entry Q9Z0G0). The plasmid is exactly as described in the associated publication.
Proper citation: RRID:Addgene_35791 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
