Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 182 showing 3621 ~ 3640 out of 12,959 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_8414

    This resource has 1+ mentions.

http://www.addgene.org/8414

Species: Mus musculus
Genetic Insert: Mouse Protein Kinase C zeta
Vector Backbone Description: Backbone Size:11500; Vector Backbone:pMTH; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8376369

Proper citation: RRID:Addgene_8414 Copy   


  • RRID:Addgene_61086

http://www.addgene.org/61086

Species: Mus musculus
Genetic Insert: smallest constitutive BIN1excluding exon 7, 11, 13-17
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:8123; Vector Backbone:pDEST27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24836577

Proper citation: RRID:Addgene_61086 Copy   


  • RRID:Addgene_61093

http://www.addgene.org/61093

Species: Mus musculus
Genetic Insert: Mag genomic sequence
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psiCheck2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23704325

Proper citation: RRID:Addgene_61093 Copy   


  • RRID:Addgene_61090

http://www.addgene.org/61090

Species: Mus musculus
Genetic Insert: hnRNP A1
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pHMTC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23704325

Proper citation: RRID:Addgene_61090 Copy   


  • RRID:Addgene_61096

http://www.addgene.org/61096

Species: Mus musculus
Genetic Insert: mouse BIN1 with exon 17, excluding exon 7, 11, 13-16
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:8123; Vector Backbone:pDEST27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24836577

Proper citation: RRID:Addgene_61096 Copy   


http://www.addgene.org/61292

Species: Mus musculus
Genetic Insert: IL-6 promoter
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12626566
Comments: Contains point mutations in both AP-1 and C/EBP binding sites. See Table 1 of associated publication for more details. Full sequence and map is available for wild-type vector pmIL-6 FL (Plasmid #61290)

Proper citation: RRID:Addgene_61292 Copy   


http://www.addgene.org/61235

Species: Mus musculus
Genetic Insert: Dixdc1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pENTR/pTER+; Vector Types:ENTR clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25042806

Proper citation: RRID:Addgene_61235 Copy   


http://www.addgene.org/61233

Species: Mus musculus
Genetic Insert: Dixdc1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pLentiX2-PURO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25042806

Proper citation: RRID:Addgene_61233 Copy   


http://www.addgene.org/61232

Species: Mus musculus
Genetic Insert: Dixdc1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pLentiX2-PURO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25042806

Proper citation: RRID:Addgene_61232 Copy   


  • RRID:Addgene_61286

    This resource has 1+ mentions.

http://www.addgene.org/61286

Species: Mus musculus
Genetic Insert: IL-6 promoter
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12626566

Proper citation: RRID:Addgene_61286 Copy   


http://www.addgene.org/61514

Species: Mus musculus
Genetic Insert: gccgctcccggatctcctgc
Vector Backbone Description: Vector Backbone:px335; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25569111

Proper citation: RRID:Addgene_61514 Copy   


http://www.addgene.org/61516

Species: Mus musculus
Genetic Insert: Mettl3
Vector Backbone Description: Vector Backbone:pBRPy; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25569111

Proper citation: RRID:Addgene_61516 Copy   


  • RRID:Addgene_61471

    This resource has 1+ mentions.

http://www.addgene.org/61471

Species: Mus musculus
Genetic Insert: Ngn2
Vector Backbone Description: Backbone Marker:Lab of David Baltimore; Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25403753

Proper citation: RRID:Addgene_61471 Copy   


  • RRID:Addgene_61535

http://www.addgene.org/61535

Species: Mus musculus
Genetic Insert: Hes3
Vector Backbone Description: Backbone Size:8376; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25454632

Proper citation: RRID:Addgene_61535 Copy   


  • RRID:Addgene_61532

    This resource has 1+ mentions.

http://www.addgene.org/61532

Species: Mus musculus
Genetic Insert: Bmi1
Vector Backbone Description: Backbone Size:8376; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25454632

Proper citation: RRID:Addgene_61532 Copy   


  • RRID:Addgene_61544

http://www.addgene.org/61544

Species: Mus musculus
Genetic Insert: Rfx4
Vector Backbone Description: Backbone Size:8376; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25454632

Proper citation: RRID:Addgene_61544 Copy   


  • RRID:Addgene_61545

http://www.addgene.org/61545

Species: Mus musculus
Genetic Insert: Sox1
Vector Backbone Description: Backbone Size:8376; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25454632

Proper citation: RRID:Addgene_61545 Copy   


http://www.addgene.org/61429

Species: Mus musculus
Genetic Insert: mCry1
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25228643

Proper citation: RRID:Addgene_61429 Copy   


  • RRID:Addgene_61541

http://www.addgene.org/61541

Species: Mus musculus
Genetic Insert: Pax6
Vector Backbone Description: Backbone Size:8376; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25454632

Proper citation: RRID:Addgene_61541 Copy   


http://www.addgene.org/61430

Species: Mus musculus
Genetic Insert: mPER2
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25228643

Proper citation: RRID:Addgene_61430 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X