Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: GFP E17TAG/Q157TAG
Vector Backbone Description: Vector Backbone:pCRT7/NT-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26350500
Comments: Encodes reporter protein to assess efficiency of phosphoserine incorporation at TAG codons.
Proper citation: RRID:Addgene_68299 Copy
Species: Synthetic
Genetic Insert: RiCas9
Vector Backbone Description: Vector Backbone:pDREAM; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_68332 Copy
Species: Synthetic
Genetic Insert: 3xgRNA;PTENA, p53B,SMAD4A
Vector Backbone Description: Backbone Size:2500; Vector Backbone:Amp; Vector Types:Mammalian Expression, AAV, Flp/Frt; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34208747
Proper citation: RRID:Addgene_68346 Copy
Species: Synthetic
Genetic Insert: puromycin
Vector Backbone Description: Backbone Size:2500; Vector Backbone:Amp; Vector Types:Mammalian Expression, CRISPR, Flp/Frt; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34208747
Proper citation: RRID:Addgene_68345 Copy
Species: Synthetic
Genetic Insert: P53 exon 7 gRNA
Vector Backbone Description: Backbone Size:2500; Vector Backbone:amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_68351 Copy
Species: Synthetic
Genetic Insert: SMAD exon 2 gRNA
Vector Backbone Description: Backbone Size:2500; Vector Backbone:amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_68350 Copy
Species: Synthetic
Genetic Insert: 5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
Vector Backbone Description: Backbone Size:2500; Vector Backbone:Amp; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_68357 Copy
Species: Synthetic
Genetic Insert: ST-Cas9-VPR
Vector Backbone Description: Vector Backbone:M-ST1cas Plasmid #48669; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26344044
Proper citation: RRID:Addgene_68498 Copy
Species: Synthetic
Genetic Insert: SP-Cas9-VPR
Vector Backbone Description: Vector Backbone:hCas9 Plasmid #41815; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26344044
Proper citation: RRID:Addgene_68497 Copy
Species: Synthetic
Genetic Insert: INT construct_bearing the GFP aptamer
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising a GFP aptamer.
Proper citation: RRID:Addgene_68428 Copy
Species: Synthetic
Genetic Insert: INT construct_bearing three MS2 Stem-loops
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising a casette of MS2 stem-loops
Proper citation: RRID:Addgene_68426 Copy
Species: Synthetic
Genetic Insert: INT construct with S1 streptavidin aptamer
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising the S1 streptavidin aptamer
Proper citation: RRID:Addgene_68425 Copy
Species: Synthetic
Genetic Insert: TOP1 construct
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA core targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains a 3'-"accessory domain," comprising the T. thermophilia P4-P6 domain appended with a casette of PP7 stem-loops
Proper citation: RRID:Addgene_68423 Copy
Species: Synthetic
Genetic Insert: INT construct_bearing the "Spinach2" aptamer
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising the "Spinach2" aptamer
Proper citation: RRID:Addgene_68430 Copy
Species: Synthetic
Genetic Insert: V48 ELP
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5547; Vector Backbone:PET25b+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22434766
Proper citation: RRID:Addgene_68395 Copy
Species: Synthetic
Genetic Insert: S48I48 ELP
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5547; Vector Backbone:PET25b+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22434766
Proper citation: RRID:Addgene_68394 Copy
Species: Synthetic
Genetic Insert: V96 ELP
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5547; Vector Backbone:PET25b+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22434766
Proper citation: RRID:Addgene_68392 Copy
Species: Synthetic
Genetic Insert: Knob-S48I48
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5547; Vector Backbone:Pet25b+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21699930
Proper citation: RRID:Addgene_68391 Copy
Species: Synthetic
Genetic Insert: INT construct_bearing three PP7 Stem-loops
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA core targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising a casette of PP7 stem-loops. Trascription termination is by the U1 snRNA 3' Box system, preceeded by the U2 snRNA sm Box.
Proper citation: RRID:Addgene_68438 Copy
Species: Synthetic
Genetic Insert: TOP1 construct
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA core targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains a 3' -"accessory domain," comprising the T. thermophilia P4-P6 domain appended with a casette of PP7 stem-loops. Trascription termination is by the U1 snRNA 3' Box system, preceeded by the U2 snRNA sm Box.
Proper citation: RRID:Addgene_68437 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
