Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:synthetic (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

30,421 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
GFP E17TAG/Q157TAG
 
Resource Report
Resource Website 		RRID:Addgene_68299 GFP E17TAG/Q157TAG Synthetic Ampicillin PMID:26350500 Encodes reporter protein to assess efficiency of phosphoserine incorporation at TAG codons. Vector Backbone:pCRT7/NT-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:42 0
PX395 Roseburia intestinalis Cas9
 
Resource Report
Resource Website 		RRID:Addgene_68332 RiCas9 Synthetic Ampicillin Vector Backbone:pDREAM; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:18:42 0
AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68346 3xgRNA;PTENA, p53B,SMAD4A Synthetic Ampicillin PMID:34208747 Backbone Size:2500; Vector Backbone:Amp; Vector Types:Mammalian Expression, AAV, Flp/Frt; Bacterial Resistance:Ampicillin 2026-08-15 01:18:42 1
LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68345 puromycin Synthetic Ampicillin PMID:34208747 Backbone Size:2500; Vector Backbone:Amp; Vector Types:Mammalian Expression, CRISPR, Flp/Frt; Bacterial Resistance:Ampicillin 2026-08-15 01:18:47 1
px330_P53 exon 7 gRNA
 
Resource Report
Resource Website 		RRID:Addgene_68351 P53 exon 7 gRNA Synthetic Ampicillin Backbone Size:2500; Vector Backbone:amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:47 0
px330_SMAD exon 2 gRNA
 
Resource Report
Resource Website 		RRID:Addgene_68350 SMAD exon 2 gRNA Synthetic Ampicillin Backbone Size:2500; Vector Backbone:amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:42 0
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
 
Resource Report
Resource Website 		RRID:Addgene_68357 5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 Synthetic Ampicillin Backbone Size:2500; Vector Backbone:Amp; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:18:47 0
M-ST1-VPR
 
Resource Report
Resource Website 		RRID:Addgene_68498 ST-Cas9-VPR Synthetic Ampicillin PMID:26344044 Vector Backbone:M-ST1cas Plasmid #48669; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:44 0
hCas9-VPR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68497 SP-Cas9-VPR Synthetic Ampicillin PMID:26344044 Vector Backbone:hCas9 Plasmid #41815; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:49 3
pU6_(GLuc)_INT[GFPApt]
 
Resource Report
Resource Website 		RRID:Addgene_68428 INT construct_bearing the GFP aptamer Synthetic Ampicillin PMID:26030444 sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising a GFP aptamer. Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:18:43 0
pU6_(GLuc)_INT[3xMS2_SL]
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68426 INT construct_bearing three MS2 Stem-loops Synthetic Ampicillin PMID:26030444 sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising a casette of MS2 stem-loops Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:18:43 3
pU6_(GLuc)_INT[S1Apt]
 
Resource Report
Resource Website 		RRID:Addgene_68425 INT construct with S1 streptavidin aptamer Synthetic Ampicillin PMID:26030444 sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising the S1 streptavidin aptamer Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:18:48 0
pU6_(GLuc)_TOP1
 
Resource Report
Resource Website 		RRID:Addgene_68423 TOP1 construct Synthetic Ampicillin PMID:26030444 sgRNA core targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains a 3'-"accessory domain," comprising the T. thermophilia P4-P6 domain appended with a casette of PP7 stem-loops Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:18:43 0
pU6_(GLuc)_INT[Spinach2]
 
Resource Report
Resource Website 		RRID:Addgene_68430 INT construct_bearing the "Spinach2" aptamer Synthetic Ampicillin PMID:26030444 sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising the "Spinach2" aptamer Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:18:43 0
V48 ELP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68395 V48 ELP Synthetic Ampicillin PMID:22434766 Backbone Marker:Novagen; Backbone Size:5547; Vector Backbone:PET25b+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:43 3
S48I48 ELP
 
Resource Report
Resource Website 		RRID:Addgene_68394 S48I48 ELP Synthetic Ampicillin PMID:22434766 Backbone Marker:Novagen; Backbone Size:5547; Vector Backbone:PET25b+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:48 0
V96 ELP
 
Resource Report
Resource Website 		RRID:Addgene_68392 V96 ELP Synthetic Ampicillin PMID:22434766 Backbone Marker:Novagen; Backbone Size:5547; Vector Backbone:PET25b+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:43 0
knob-s48i48
 
Resource Report
Resource Website 		RRID:Addgene_68391 Knob-S48I48 Synthetic Ampicillin PMID:21699930 Backbone Marker:Novagen; Backbone Size:5547; Vector Backbone:Pet25b+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:48 0
pU1/Sm/3' Box_(GLuc)_INT
 
Resource Report
Resource Website 		RRID:Addgene_68438 INT construct_bearing three PP7 Stem-loops Synthetic Ampicillin PMID:26030444 sgRNA core targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising a casette of PP7 stem-loops. Trascription termination is by the U1 snRNA 3' Box system, preceeded by the U2 snRNA sm Box. Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:18:48 0
pU1/Sm/3' Box_(GLuc)_TOP1
 
Resource Report
Resource Website 		RRID:Addgene_68437 TOP1 construct Synthetic Ampicillin PMID:26030444 sgRNA core targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains a 3' -"accessory domain," comprising the T. thermophilia P4-P6 domain appended with a casette of PP7 stem-loops. Trascription termination is by the U1 snRNA 3' Box system, preceeded by the U2 snRNA sm Box. Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:18:43 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch