Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: Ash1
Vector Backbone Description: Backbone Marker:invitrogen; Vector Backbone:pDEST17; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27807972
Proper citation: RRID:Addgene_169711 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: gRNA for MATa
Vector Backbone Description: Vector Backbone:pRS426; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29150593
Proper citation: RRID:Addgene_169455 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Mata locus
Vector Backbone Description: Vector Backbone:pCR™-Blunt II-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29150593
Proper citation: RRID:Addgene_169456 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Added HLM1 to the C-terminal end of Dcp2C Δ5H.
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163584 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Added HLM1 to the C-terminal end of Dcp2 FL.
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163583 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Lacking N-terminal domain, which binds RNA and has enzymatic activities.
5' sequenceing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163575 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Impaired Edc3 binding site (first HLM).
5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163576 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: impaired RNA binding. 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163579 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Lacking C-terminal domain, impaired Edc3 binding site (first HLM).
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163578 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL4
Vector Backbone Description: Backbone Size:8902; Vector Backbone:pBDP; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18621688
Comments: pBPGw is a modular Gateway compatible promoter-less GAL4 vector amenable to high throughput in vitro cloning using Invitrogen LR clonase and specific in vivo genomic targeting using PhiC31 integrase. In addition the GAL4 CDS and yeast transcriptional terminator can easily be substituted for another driver by a directional 5' KpnI to 3' HindIII digest.
Proper citation: RRID:Addgene_17574 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL4
Vector Backbone Description: Backbone Size:9052; Vector Backbone:pBDP; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18621688
Comments: pBPGUw is a modular Gateway compatible GAL4 vector amenable to high throughput in vitro cloning using Invitrogen LR clonase and specific in vivo genomic targeting using PhiC31 integrase. pBPGUw contains a Drosophila synthetic core promoter (DSCP) that contains TATA, Inr, MTE, and DPE motifs. In addition the GAL4 CDS and yeast transcriptional terminator can easily be substituted for another driver by a directional 5' KpnI to 3' HindIII digest.
Proper citation: RRID:Addgene_17575 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 5' homology for integration site X-2
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016).
Proper citation: RRID:Addgene_176162 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 5' homology for integration site XII-5
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016).
Proper citation: RRID:Addgene_176176 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 3' homology for integration site XI-3
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016).
Proper citation: RRID:Addgene_176171 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 3' homology for integration site XI-5
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016).
Proper citation: RRID:Addgene_176173 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 3' homology for integration site X-4
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016).
Proper citation: RRID:Addgene_176165 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 5' homology for integration site XI-2
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016).
Proper citation: RRID:Addgene_176168 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 5' homology for integration site X-4
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016).
Proper citation: RRID:Addgene_176164 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 3' homology for integration site X-2
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016).
Proper citation: RRID:Addgene_176163 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TPK2+ccdB dropout cassette
Vector Backbone Description: Vector Backbone:MoClo assembly; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015) from the part plasmids pYTK002, pMC234r-ccdB/TPK2, pYTK067, pYTK074, pYTK081, pYTK083.
Proper citation: RRID:Addgene_176183 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
