Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 185 showing 3681 ~ 3700 out of 30,421 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/68436

Species: Synthetic
Genetic Insert: INT construct_bearing three PP7 Stem-loops
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising a casette of PP7 stem-loops. Trascription termination is by the U1 snRNA 3' Box system.

Proper citation: RRID:Addgene_68436 Copy   


http://www.addgene.org/68461

Species: Synthetic
Genetic Insert: mammalian-codon-optimized Flpe recombinase fused with ERT2
Vector Backbone Description: Backbone Size:8085; Vector Backbone:AAVS1-CAG; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26145478

Proper citation: RRID:Addgene_68461 Copy   


  • RRID:Addgene_68708

    This resource has 10+ mentions.

http://www.addgene.org/68708

Species: Synthetic
Genetic Insert: Fusion gene Cas9-HA-2xNLS-GFP from vector pMJ920 (Addgene) .
Vector Backbone Description: Backbone Marker:Vazquez and Levin., 1999; Backbone Size:6227; Vector Backbone:pTREX-n; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26199333

Proper citation: RRID:Addgene_68708 Copy   


  • RRID:Addgene_68769

http://www.addgene.org/68769

Species: Synthetic
Genetic Insert: CIS-V3m
Vector Backbone Description: Backbone Size:4501; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572

Proper citation: RRID:Addgene_68769 Copy   


  • RRID:Addgene_68760

http://www.addgene.org/68760

Species: Synthetic
Genetic Insert: ZF9-TF-V1
Vector Backbone Description: Backbone Marker:invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-NEO-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26389572

Proper citation: RRID:Addgene_68760 Copy   


  • RRID:Addgene_68768

http://www.addgene.org/68768

Species: Synthetic
Genetic Insert: CIS-V3
Vector Backbone Description: Backbone Size:4501; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572

Proper citation: RRID:Addgene_68768 Copy   


  • RRID:Addgene_68767

http://www.addgene.org/68767

Species: Synthetic
Genetic Insert: CIS-V2m
Vector Backbone Description: Backbone Size:4501; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572

Proper citation: RRID:Addgene_68767 Copy   


  • RRID:Addgene_68766

http://www.addgene.org/68766

Species: Synthetic
Genetic Insert: CIS-V2
Vector Backbone Description: Backbone Size:4501; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572

Proper citation: RRID:Addgene_68766 Copy   


  • RRID:Addgene_68764

http://www.addgene.org/68764

Species: Synthetic
Genetic Insert: CIS-V1
Vector Backbone Description: Backbone Size:4501; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572

Proper citation: RRID:Addgene_68764 Copy   


  • RRID:Addgene_68814

    This resource has 1+ mentions.

http://www.addgene.org/68814

Species: Synthetic
Genetic Insert: Cdc42 activation reporter
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5238; Vector Backbone:pTriEx4; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26912264

Proper citation: RRID:Addgene_68814 Copy   


  • RRID:Addgene_68813

    This resource has 1+ mentions.

http://www.addgene.org/68813

Species: Synthetic
Genetic Insert: Cdc42 activation reporter
Vector Backbone Description: Backbone Size:7714; Vector Backbone:pRRL- SV40(puro)_CMV(mcs); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26912264

Proper citation: RRID:Addgene_68813 Copy   


  • RRID:Addgene_68770

http://www.addgene.org/68770

Species: Synthetic
Genetic Insert: C-terminal Sensor 1 V1
Vector Backbone Description: Backbone Marker:invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-NEO-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26389572

Proper citation: RRID:Addgene_68770 Copy   


  • RRID:Addgene_68778

    This resource has 1+ mentions.

http://www.addgene.org/68778

Species: Synthetic
Genetic Insert: 8x 4gap Target 1
Vector Backbone Description: Backbone Size:4522; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572

Proper citation: RRID:Addgene_68778 Copy   


  • RRID:Addgene_68777

    This resource has 1+ mentions.

http://www.addgene.org/68777

Species: Synthetic
Genetic Insert: 8x 0gap Target
Vector Backbone Description: Backbone Size:4522; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572

Proper citation: RRID:Addgene_68777 Copy   


  • RRID:Addgene_68775

http://www.addgene.org/68775

Species: Synthetic
Genetic Insert: C-Terminal Sensor 1 V3
Vector Backbone Description: Backbone Marker:invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-NEO-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26389572

Proper citation: RRID:Addgene_68775 Copy   


  • RRID:Addgene_68780

    This resource has 1+ mentions.

http://www.addgene.org/68780

Species: Synthetic
Genetic Insert: 8x 12gap Target 1
Vector Backbone Description: Backbone Size:4522; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572

Proper citation: RRID:Addgene_68780 Copy   


  • RRID:Addgene_68783

http://www.addgene.org/68783

Species: Synthetic
Genetic Insert: 3x 0gap Target 1
Vector Backbone Description: Backbone Size:4522; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572

Proper citation: RRID:Addgene_68783 Copy   


  • RRID:Addgene_68837

    This resource has 1+ mentions.

http://www.addgene.org/68837

Species: Synthetic
Genetic Insert: Ancestral AAV Capsid Anc80L65
Vector Backbone Description: Backbone Size:5238; Vector Backbone:synthetic; Vector Types:Mammalian Expression, AAV, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26235624
Comments: An improved version of this plasmid from the Vandenberghe Lab is available. Please see pAnc80L65AAP (Addgene plasmid# 92307). This plasmid, pAnc80L65 (#68837), requires cotransfection with a plasmid expressing AAP. For efficient viral vector production without cotransfecting AAP, use pAnc80L65AAP (Addgene plasmid# 92307)

Proper citation: RRID:Addgene_68837 Copy   


  • RRID:Addgene_68791

    This resource has 1+ mentions.

http://www.addgene.org/68791

Species: Synthetic
Genetic Insert: ZF9 Op 6x
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4917; Vector Backbone:pGL4.26 luc2/minp/hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572

Proper citation: RRID:Addgene_68791 Copy   


  • RRID:Addgene_68795

http://www.addgene.org/68795

Species: Synthetic
Genetic Insert: C-Terminal Sensor 1 V1
Vector Backbone Description: Backbone Marker:invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-NEO-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26389572

Proper citation: RRID:Addgene_68795 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X