Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
psicheck-2-Mut mod Resource Report Resource Website |
RRID:Addgene_48165 | 5" UTR of Mut | Mus musculus | Ampicillin | PMID:19372376 | Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psicheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | A/T mutation in the ATG of the uORF | 2026-08-15 01:15:48 | 0 | |
|
psicheck-2-Acsm2 Resource Report Resource Website |
RRID:Addgene_48158 | 5" UTR of Acsm2 | Mus musculus | Ampicillin | PMID:19372376 | Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psicheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:48 | 0 | ||
|
pLew90β-GW/T7/PARP SAS/luciferase/Aldolase 3′UTR Resource Report Resource Website |
RRID:Addgene_48157 | luciferase | P. pyralis | Ampicillin | PMID:20644616 | Backbone Marker:Courtney Boehlke; Backbone Size:7000; Vector Backbone:pLew90β-T7-GW-Neo; Vector Types:Luciferase, T. cruzi expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:48 | 0 | ||
|
pPSP6+t Resource Report Resource Website |
RRID:Addgene_48149 | Ampicillin | PMID:20596705 | Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:48 | 0 | ||||
|
pPK1E-1 Resource Report Resource Website |
RRID:Addgene_48145 | Ampicillin | PMID:20596705 | Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:48 | 0 | ||||
|
pPK1E-2 Resource Report Resource Website |
RRID:Addgene_48146 | Ampicillin | PMID:20596705 | Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:48 | 0 | ||||
|
pSP6-RNAP Resource Report Resource Website 1+ mentions |
RRID:Addgene_48143 | rna polymerase SP6 | Ampicillin | PMID:20596705 | Please note that the V313A mutation in RNAP was present in the original sample and functions as described in the publication. | Backbone Marker:Gamer et al., 2009; Vector Backbone:pMGBm19; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | V314A (numbering based on NCBI Sequence ID: NP_853568.1) | 2026-08-15 01:15:48 | 1 | |
|
pK1E-RNAP Resource Report Resource Website |
RRID:Addgene_48144 | rna polymerase K1E | Ampicillin | PMID:20596705 | Backbone Marker:Gamer et al., 2009; Vector Backbone:pMGBm19; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:48 | 0 | |||
|
pSpCas9(BB)-2A-GFP (PX458) Resource Report Resource Website 1000+ mentions |
RRID:Addgene_48138 | hSpCas9 | Synthetic | Ampicillin | PMID:24157548 | For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/. | Vector Backbone:PX458; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:48 | 2375 | |
|
pPK1E-1+t-gfp Resource Report Resource Website 1+ mentions |
RRID:Addgene_48131 | gfp | Ampicillin | PMID:20596705 | Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:47 | 1 | |||
|
pGEX-5x3-hMeCP2-delN256-G273X Resource Report Resource Website |
RRID:Addgene_48090 | Methyl-CpG Binding Protein 2 (Rett Syndrome) | Homo sapiens | Ampicillin | PMID:23452848 | Backbone Size:4974; Vector Backbone:pGEX-5x3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | deleted the N-terminal 256 codons, expresses AT-Hook G273X | 2026-08-15 01:15:47 | 0 | |
|
pTXB1-hMeCP2-R270X Resource Report Resource Website |
RRID:Addgene_48092 | Methyl-CpG Binding Protein 2 (Rett Syndrome) | Homo sapiens | Ampicillin | PMID:23452848 | Backbone Size:6706; Vector Backbone:pTXB1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Mxe intein/chitin binding domain tagged, expresses AT-Hook R270X | 2026-08-15 01:15:47 | 0 | |
|
pCMX-Gal4-hMeCP2-R270X-R111G Resource Report Resource Website |
RRID:Addgene_48086 | Methyl-CpG Binding Protein 2 (Rett Syndrome) | Homo sapiens | Ampicillin | PMID:23452848 | Backbone Size:4500; Vector Backbone:pCMX-Gal4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R111G mutant MeCP2, expresses AT-hook R270X | 2026-08-15 01:15:47 | 0 | |
|
pCMX-Gal4-hMeCP2-G273X Resource Report Resource Website |
RRID:Addgene_48084 | Methyl-CpG Binding Protein 2 (Rett Syndrome) | Homo sapiens | Ampicillin | PMID:23452848 | Backbone Size:4500; Vector Backbone:pCMX-Gal4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | expresses AT-Hook G273X | 2026-08-15 01:15:47 | 0 | |
|
pSPPac-hp Resource Report Resource Website |
RRID:Addgene_48123 | signal peptide of Pac | Ampicillin | PMID:20435764 | Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:47 | 0 | |||
|
pSPYngK+-hp Resource Report Resource Website |
RRID:Addgene_48121 | codon optimized signal peptide of YngK | Ampicillin | PMID:20435764 | Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:47 | 0 | |||
|
pGEX-5x3-hMeCP2-delN256-R270X Resource Report Resource Website |
RRID:Addgene_48089 | Methyl-CpG Binding Protein 2 (Rett Syndrome) | Homo sapiens | Ampicillin | PMID:23452848 | Backbone Size:4974; Vector Backbone:pGEX-5x3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | deleted the N-terminal 256 codons, expresses AT-Hook R270X | 2026-08-15 01:15:47 | 0 | |
|
pAC152-dual-dCas9VP64-sgExpression Resource Report Resource Website 1+ mentions |
RRID:Addgene_48238 | dCas9 | Synthetic | Ampicillin | PMID:23979020 | Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT For more information including protocols and updates, please go to http://www.crispr-on.org | Vector Backbone:pX335 (Addgene #42335); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | D10A;H840A | 2026-08-15 01:15:48 | 3 |
|
IpO Resource Report Resource Website 1+ mentions |
RRID:Addgene_48233 | URA3 3' fragment | Saccharomyces cerevisiae | Ampicillin | PMID:24604451 | Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin | URA3 ORF from +216 to 80 bp downstream of the stop codon | 2026-08-15 01:15:48 | 1 | |
|
pAC103-PBNeo-U6-sgRNA-Expression Resource Report Resource Website |
RRID:Addgene_48228 | Ampicillin | PMID:23979020 | For more information including protocols and updates, please go to http://www.crispr-on.org | Backbone Marker:Invitrogen; Vector Backbone:pCR4; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:48 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
