Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:synthetic (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

30,421 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pCMV/3' Box_(GLuc)_INT
 
Resource Report
Resource Website 		RRID:Addgene_68436 INT construct_bearing three PP7 Stem-loops Synthetic Ampicillin PMID:26030444 sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising a casette of PP7 stem-loops. Trascription termination is by the U1 snRNA 3' Box system. Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:18:43 0
AAVS1-Blasticidin-CAG-Flpe-ERT2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68461 mammalian-codon-optimized Flpe recombinase fused with ERT2 Synthetic Ampicillin PMID:26145478 Backbone Size:8085; Vector Backbone:AAVS1-CAG; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:18:44 3
Cas9/pTREX-n
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_68708 Fusion gene Cas9-HA-2xNLS-GFP from vector pMJ920 (Addgene) . Synthetic Ampicillin PMID:26199333 Backbone Marker:Vazquez and Levin., 1999; Backbone Size:6227; Vector Backbone:pTREX-n; Vector Types:CRISPR; Bacterial Resistance:Ampicillin C4239T mutation that eliminates a BamHI restriction site on the Cas9-GFP ORF. 2026-08-15 01:18:51 11
pBW121-SS-281
 
Resource Report
Resource Website 		RRID:Addgene_68769 CIS-V3m Synthetic Ampicillin PMID:26389572 Backbone Size:4501; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:47 0
pVITRO1-SS-246
 
Resource Report
Resource Website 		RRID:Addgene_68760 ZF9-TF-V1 Synthetic Kanamycin PMID:26389572 Backbone Marker:invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-NEO-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:47 0
pBW121-SS-280
 
Resource Report
Resource Website 		RRID:Addgene_68768 CIS-V3 Synthetic Ampicillin PMID:26389572 Backbone Size:4501; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:47 0
pBW121-SS-279
 
Resource Report
Resource Website 		RRID:Addgene_68767 CIS-V2m Synthetic Ampicillin PMID:26389572 Backbone Size:4501; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:52 0
pBW121-SS-278
 
Resource Report
Resource Website 		RRID:Addgene_68766 CIS-V2 Synthetic Ampicillin PMID:26389572 Backbone Size:4501; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:47 0
pBW121-SS-276
 
Resource Report
Resource Website 		RRID:Addgene_68764 CIS-V1 Synthetic Ampicillin PMID:26389572 Backbone Size:4501; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:52 0
pTriEx4-Cdc42-2G
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68814 Cdc42 activation reporter Synthetic Ampicillin PMID:26912264 Backbone Marker:Novagen; Backbone Size:5238; Vector Backbone:pTriEx4; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:47 8
pLenti-Cdc42-2G
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68813 Cdc42 activation reporter Synthetic Ampicillin PMID:26912264 Backbone Size:7714; Vector Backbone:pRRL- SV40(puro)_CMV(mcs); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:18:47 3
pVITRO1-SS-267
 
Resource Report
Resource Website 		RRID:Addgene_68770 C-terminal Sensor 1 V1 Synthetic Kanamycin PMID:26389572 Backbone Marker:invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-NEO-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:52 0
pBW121-SS-310
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68778 8x 4gap Target 1 Synthetic Ampicillin PMID:26389572 Backbone Size:4522; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:47 1
pBW121-SS-309
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68777 8x 0gap Target Synthetic Ampicillin PMID:26389572 Backbone Size:4522; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:47 1
pVITRO1-SS-259
 
Resource Report
Resource Website 		RRID:Addgene_68775 C-Terminal Sensor 1 V3 Synthetic Kanamycin PMID:26389572 Backbone Marker:invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-NEO-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:47 0
pBW121-SS-311
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68780 8x 12gap Target 1 Synthetic Ampicillin PMID:26389572 Backbone Size:4522; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:47 1
pBW121-SS-299
 
Resource Report
Resource Website 		RRID:Addgene_68783 3x 0gap Target 1 Synthetic Ampicillin PMID:26389572 Backbone Size:4522; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:47 0
pAnc80L65
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68837 Ancestral AAV Capsid Anc80L65 Synthetic Kanamycin PMID:26235624 An improved version of this plasmid from the Vandenberghe Lab is available. Please see pAnc80L65AAP (Addgene plasmid# 92307). This plasmid, pAnc80L65 (#68837), requires cotransfection with a plasmid expressing AAP. For efficient viral vector production without cotransfecting AAP, use pAnc80L65AAP (Addgene plasmid# 92307) Backbone Size:5238; Vector Backbone:synthetic; Vector Types:Mammalian Expression, AAV, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:18:47 4
pGL4.26-SS-352
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68791 ZF9 Op 6x Synthetic Ampicillin PMID:26389572 Backbone Marker:Promega; Backbone Size:4917; Vector Backbone:pGL4.26 luc2/minp/hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:47 1
pVITRO1-SS-338
 
Resource Report
Resource Website 		RRID:Addgene_68795 C-Terminal Sensor 1 V1 Synthetic Kanamycin PMID:26389572 Backbone Marker:invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-NEO-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:52 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch