Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: INT construct_bearing three PP7 Stem-loops
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising a casette of PP7 stem-loops. Trascription termination is by the U1 snRNA 3' Box system.
Proper citation: RRID:Addgene_68436 Copy
Species: Synthetic
Genetic Insert: mammalian-codon-optimized Flpe recombinase fused with ERT2
Vector Backbone Description: Backbone Size:8085; Vector Backbone:AAVS1-CAG; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26145478
Proper citation: RRID:Addgene_68461 Copy
Species: Synthetic
Genetic Insert: Fusion gene Cas9-HA-2xNLS-GFP from vector pMJ920 (Addgene) .
Vector Backbone Description: Backbone Marker:Vazquez and Levin., 1999; Backbone Size:6227; Vector Backbone:pTREX-n; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26199333
Proper citation: RRID:Addgene_68708 Copy
Species: Synthetic
Genetic Insert: CIS-V3m
Vector Backbone Description: Backbone Size:4501; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572
Proper citation: RRID:Addgene_68769 Copy
Species: Synthetic
Genetic Insert: ZF9-TF-V1
Vector Backbone Description: Backbone Marker:invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-NEO-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26389572
Proper citation: RRID:Addgene_68760 Copy
Species: Synthetic
Genetic Insert: CIS-V3
Vector Backbone Description: Backbone Size:4501; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572
Proper citation: RRID:Addgene_68768 Copy
Species: Synthetic
Genetic Insert: CIS-V2m
Vector Backbone Description: Backbone Size:4501; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572
Proper citation: RRID:Addgene_68767 Copy
Species: Synthetic
Genetic Insert: CIS-V2
Vector Backbone Description: Backbone Size:4501; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572
Proper citation: RRID:Addgene_68766 Copy
Species: Synthetic
Genetic Insert: CIS-V1
Vector Backbone Description: Backbone Size:4501; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572
Proper citation: RRID:Addgene_68764 Copy
Species: Synthetic
Genetic Insert: Cdc42 activation reporter
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5238; Vector Backbone:pTriEx4; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26912264
Proper citation: RRID:Addgene_68814 Copy
Species: Synthetic
Genetic Insert: Cdc42 activation reporter
Vector Backbone Description: Backbone Size:7714; Vector Backbone:pRRL- SV40(puro)_CMV(mcs); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26912264
Proper citation: RRID:Addgene_68813 Copy
Species: Synthetic
Genetic Insert: C-terminal Sensor 1 V1
Vector Backbone Description: Backbone Marker:invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-NEO-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26389572
Proper citation: RRID:Addgene_68770 Copy
Species: Synthetic
Genetic Insert: 8x 4gap Target 1
Vector Backbone Description: Backbone Size:4522; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572
Proper citation: RRID:Addgene_68778 Copy
Species: Synthetic
Genetic Insert: 8x 0gap Target
Vector Backbone Description: Backbone Size:4522; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572
Proper citation: RRID:Addgene_68777 Copy
Species: Synthetic
Genetic Insert: C-Terminal Sensor 1 V3
Vector Backbone Description: Backbone Marker:invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-NEO-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26389572
Proper citation: RRID:Addgene_68775 Copy
Species: Synthetic
Genetic Insert: 8x 12gap Target 1
Vector Backbone Description: Backbone Size:4522; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572
Proper citation: RRID:Addgene_68780 Copy
Species: Synthetic
Genetic Insert: 3x 0gap Target 1
Vector Backbone Description: Backbone Size:4522; Vector Backbone:pBW121; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572
Proper citation: RRID:Addgene_68783 Copy
Species: Synthetic
Genetic Insert: Ancestral AAV Capsid Anc80L65
Vector Backbone Description: Backbone Size:5238; Vector Backbone:synthetic; Vector Types:Mammalian Expression, AAV, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26235624
Comments: An improved version of this plasmid from the Vandenberghe Lab is available. Please see pAnc80L65AAP (Addgene plasmid# 92307).
This plasmid, pAnc80L65 (#68837), requires cotransfection with a plasmid expressing AAP. For efficient viral vector production without cotransfecting AAP, use pAnc80L65AAP (Addgene plasmid# 92307)
Proper citation: RRID:Addgene_68837 Copy
Species: Synthetic
Genetic Insert: ZF9 Op 6x
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4917; Vector Backbone:pGL4.26 luc2/minp/hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26389572
Proper citation: RRID:Addgene_68791 Copy
Species: Synthetic
Genetic Insert: C-Terminal Sensor 1 V1
Vector Backbone Description: Backbone Marker:invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-NEO-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26389572
Proper citation: RRID:Addgene_68795 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
