Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Photinus pyralis
Genetic Insert: firely luciferase
Vector Backbone Description: Backbone Marker:Martin P. Vazquez; Backbone Size:6200; Vector Backbone:pTrex; Vector Types:Trypanasoma cruzi expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29578409
Proper citation: RRID:Addgene_48336 Copy
Species: Photinus pyralis
Genetic Insert: firely luciferase
Vector Backbone Description: Backbone Marker:Martin P. Vazquez; Backbone Size:6200; Vector Backbone:pTrex; Vector Types:Trypanasoma cruzi expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20644616
Proper citation: RRID:Addgene_48337 Copy
Species: Mus musculus
Genetic Insert: 5-hydroxytriptamine receptor isoform 6
Vector Backbone Description: Backbone Size:5300; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056873
Proper citation: RRID:Addgene_48339 Copy
Vector Backbone Description: Backbone Size:4729; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a MYFQSNA fusion tag on the N-terminus
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Note: The plasmid as it is provided enocdes "MYFQSNI". However, the vector is supposed to be cut with SspI (AATATT), which is a blunt cutter that cuts between the N and the "I" (this ends up not being transcribed, however). Then, provided you use the LIC tags on your PCR primers that we've suggested, the forward primer will introduce an A residue immediately downstream of the N. The final tag, therefore, is MYFQSNA.
Proper citation: RRID:Addgene_48293 Copy
Vector Backbone Description: Backbone Size:9643; Vector Backbone:pRS422; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function.
This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.
This vector has a TEV cleavable His6-MBP tag on the N-terminus and can complement Ade auxotrophy.
Add the following tags to your PCR primers:
LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG)
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA
Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.
Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-).
For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48299 Copy
Genetic Insert: TVA receptor mCherry
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24239125
Proper citation: RRID:Addgene_48332 Copy
Vector Backbone Description: Backbone Size:6148; Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28668116
Comments: This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.
This vector has a TEV cleavable StrepII-msfGFP tag on the N-terminus.
Add the following tags to your PCR primers:
LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG)
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA
Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.
Series 11 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. For more information, please see our website: https://macrolab.qb3.berkeley.edu/dna-cloning/
Proper citation: RRID:Addgene_48297 Copy
Genetic Insert: TVA receptor mCherry fusion with the 66T mutation
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24239125
Proper citation: RRID:Addgene_48331 Copy
Vector Backbone Description: Backbone Size:4774; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV cleavable StrepII fusion tag on the N-terminusTo clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48290 Copy
Vector Backbone Description: Backbone Size:5767; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty destination vector. It is a polycistronic vector that can express up to five genes at once. Genes must first be cloned into any of our 8-series transfer vectors (8BT,8CT,8UT), then subcloned into any of the five cassettes of the destination vector:
Cassette 1: BamHI/XbaI
Cassette 2: AsiSI/PspXI
Cassette 3: SbfI/AscI
Cassette 4: AdeI/NotI
Cassette 5: PacI/FseI
Please note that you must always insert your gene into the lowest cassette number first (e.g., if you're using cassettes 2 and 3, you must put your gene into cassette 2 first, then move on to cassette 3). You do not have to use all of the cassettes.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48282 Copy
Vector Backbone Description: Backbone Size:4710; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
To clone into this vector, add LIC version 2 fusion tags to the 5' end of your PCR primers.
Forward - 5'TTTAAGAAGGAGATATAGATC3'
Reverse - 5'TTATGGAGTTGGGATCTTATTA3'In addition, ensure that your open reading frame contains an ATG start codon.
Linearize the plasmid with EcoRV and gel purify.
When digesting the DNA with T4 polymerase for LIC version 2, use dGTP for insert and dCTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48283 Copy
Vector Backbone Description: Backbone Size:4762; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV cleavable FLAG fusion tag on the N-terminus.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48288 Copy
Vector Backbone Description: Backbone Size:5134; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV cleavable His6-Mocr fusion tag on the N-terminus.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48289 Copy
Vector Backbone Description: Backbone Size:5497; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV cleavable His6-msfGFP fusion tag on the N-terminus.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48287 Copy
Vector Backbone Description: Backbone Size:6906; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8CT adds a TEV-cleavable His6-MBP tag to the N-terminus of your protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.This vector is a transfer vector that can be used in conjunction with the 8D destination vector to create a polycistronic construct. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48280 Copy
Vector Backbone Description: Backbone Size:5706; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8UT adds a MYFQSNA tag to the N-terminus of your protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
This vector is a transfer vector that can be used in conjunction with the 8D destination vector to create a polycistronic construct. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Note: The plasmid as it is provided enocdes "MYFQSNI". However, the vector is supposed to be cut with SspI (AATATT), which is a blunt cutter that cuts between the N and the "I" (this ends up not being transcribed, however). Then, provided you use the LIC tags on your PCR primers that we've suggested, the forward primer will introduce an A residue immediately downstream of the N. The final tag, therefore, is MYFQSNA.
Proper citation: RRID:Addgene_48281 Copy
Vector Backbone Description: Backbone Size:3413; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV cleavable Mocr tag on the N-terminus and Amp resistance.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The Series-14 plasmids were designed to overcome the unpredictable expression patterns of genes from a polycistronic message. As mentioned in the Series-2 and Series-9 polycistronic sections, often genes that express well from a single gene mRNA do not express at the same level when placed in a polycistronic message next to other genes. This effect is likely due to mRNA structure interfering with access to the ribosome binding site. When we first made our polypromoter plasmids we found that we could clone multiple genes together in the Xl1-Blue cells so that each possess a T7 promoter, followed by a Lac operator, followed by a ribosome binding site, followed by your open reading frame (T7-LacO-RBS-yORF). However, these multi-gene polypromoter plasmids were unable to be transformed into an expression strain such as BL-21 or Rosetta2. We then figured out that we needed a RecAexpression strain (like Rosetta-Blues) to successfully propagate our polypromoter plasmids. Although Rosetta-Blue cells propagated our plasmids, expression was not so great and we didn't want to rely on a specialized strain to perform our expression. Finally, we figured out that it was the LacO that follows the T7 promoter that was causing plasmid instability in our polypromoter system. Removal of the LacO allowed us to express our polypromoter plasmids in Rosetta2 cells and we have had much success with these plasmids since. Much like our Series- 2 plasmids, the Series-14 plasmids are going to give a substantial amount of leaky expression. However, even with this shortcoming, we have found Series-14 to be a valuable resource for expressing multi-protein complexes. Cloning into the Series-14 plasmids and subsequent biobrick subcloning is performed exactly as described for the Series-9 plasmids.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48315 Copy
Vector Backbone Description: Backbone Size:5742; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.8BT adds a TEV-cleavable His6 tag to the N-terminus of your protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
This vector is a transfer vector that can be used in conjunction with the 8D destination vector to create a polycistronic construct. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48279 Copy
Vector Backbone Description: Backbone Size:3071; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV cleavable StrepII tag on the N-terminus and Amp resistance.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The Series-14 plasmids were designed to overcome the unpredictable expression patterns of genes from a polycistronic message. As mentioned in the Series-2 and Series-9 polycistronic sections, often genes that express well from a single gene mRNA do not express at the same level when placed in a polycistronic message next to other genes. This effect is likely due to mRNA structure interfering with access to the ribosome binding site. When we first made our polypromoter plasmids we found that we could clone multiple genes together in the Xl1-Blue cells so that each possess a T7 promoter, followed by a Lac operator, followed by a ribosome binding site, followed by your open reading frame (T7-LacO-RBS-yORF). However, these multi-gene polypromoter plasmids were unable to be transformed into an expression strain such as BL-21 or Rosetta2. We then figured out that we needed a RecAexpression strain (like Rosetta-Blues) to successfully propagate our polypromoter plasmids. Although Rosetta-Blue cells propagated our plasmids, expression was not so great and we didn't want to rely on a specialized strain to perform our expression. Finally, we figured out that it was the LacO that follows the T7 promoter that was causing plasmid instability in our polypromoter system. Removal of the LacO allowed us to express our polypromoter plasmids in Rosetta2 cells and we have had much success with these plasmids since. Much like our Series- 2 plasmids, the Series-14 plasmids are going to give a substantial amount of leaky expression. However, even with this shortcoming, we have found Series-14 to be a valuable resource for expressing multi-protein complexes. Cloning into the Series-14 plasmids and subsequent biobrick subcloning is performed exactly as described for the Series-9 plasmids.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48312 Copy
Vector Backbone Description: Backbone Size:3371; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.It has a TEV cleavable His6 Sumo tag on the N-terminus and Amp resistance.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The Series-14 plasmids were designed to overcome the unpredictable expression patterns of genes from a polycistronic message. As mentioned in the Series-2 and Series-9 polycistronic sections, often genes that express well from a single gene mRNA do not express at the same level when placed in a polycistronic message next to other genes. This effect is likely due to mRNA structure interfering with access to the ribosome binding site. When we first made our polypromoter plasmids we found that we could clone multiple genes together in the Xl1-Blue cells so that each possess a T7 promoter, followed by a Lac operator, followed by a ribosome binding site, followed by your open reading frame (T7-LacO-RBS-yORF). However, these multi-gene polypromoter plasmids were unable to be transformed into an expression strain such as BL-21 or Rosetta2. We then figured out that we needed a RecAexpression strain (like Rosetta-Blues) to successfully propagate our polypromoter plasmids. Although Rosetta-Blue cells propagated our plasmids, expression was not so great and we didn't want to rely on a specialized strain to perform our expression. Finally, we figured out that it was the LacO that follows the T7 promoter that was causing plasmid instability in our polypromoter system. Removal of the LacO allowed us to express our polypromoter plasmids in Rosetta2 cells and we have had much success with these plasmids since. Much like our Series- 2 plasmids, the Series-14 plasmids are going to give a substantial amount of leaky expression. However, even with this shortcoming, we have found Series-14 to be a valuable resource for expressing multi-protein complexes. Cloning into the Series-14 plasmids and subsequent biobrick subcloning is performed exactly as described for the Series-9 plasmids.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48313 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
