Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: TIF4631
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX4t1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040
Proper citation: RRID:Addgene_37231 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TIF4631
Vector Backbone Description: Backbone Marker:EMD bioscience; Backbone Size:5420; Vector Backbone:pETDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040
Proper citation: RRID:Addgene_37232 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PAB1
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21139564
Proper citation: RRID:Addgene_37234 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TIF1
Vector Backbone Description: Backbone Marker:EMD bioscience; Backbone Size:5441; Vector Backbone:pET21c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040
Proper citation: RRID:Addgene_37230 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Met3p-mCherry-Tub1
Vector Backbone Description: Backbone Size:5504; Vector Backbone:pRS305; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19185494
Proper citation: RRID:Addgene_37553 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CAN1.y gRNA
Vector Backbone Description: Backbone Size:5886; Vector Backbone:p426; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23460208
Comments: gRNA target sequence GATACGTTCTCTATGGAGGA
Proper citation: RRID:Addgene_43803 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Atg17
Vector Backbone Description: Backbone Size:2800; Vector Backbone:pST39; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23219485
Proper citation: RRID:Addgene_44174 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ATG9
Vector Backbone Description: Backbone Size:4297; Vector Backbone:pRS406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27050455
Proper citation: RRID:Addgene_114667 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HSP104
Vector Backbone Description: Backbone Size:5703; Vector Backbone:pLA1 (pRS313:GAL1-10); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14978213
Comments: Please note that attempts to cut this plasmid and its derivatives with XhoI have failed
Proper citation: RRID:Addgene_1146 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HSP104
Vector Backbone Description: Backbone Size:5703; Vector Backbone:pLA1 (pRS313:GAL1-10); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14978213
Proper citation: RRID:Addgene_1147 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HSP104
Vector Backbone Description: Backbone Size:5703; Vector Backbone:pLA1 (pRS313:GAL1-10); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14978213
Proper citation: RRID:Addgene_1150 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HSP104
Vector Backbone Description: Backbone Size:5703; Vector Backbone:pLA1 (pRS313:GAL1-10); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14978213
Proper citation: RRID:Addgene_1152 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RPL28
Vector Backbone Description: Backbone Size:2500; Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30908907
Proper citation: RRID:Addgene_115434 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RPL28
Vector Backbone Description: Backbone Size:2500; Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30908907
Proper citation: RRID:Addgene_115435 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Sec7-iGFPx6
Vector Backbone Description: Vector Backbone:YIplac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30858194
Comments: Please note sequence is from JK93da yeast strain rather than S288C
Proper citation: RRID:Addgene_115424 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Sec7-Halox2
Vector Backbone Description: Vector Backbone:YIplac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30858194
Comments: Please note sequence is from JK93da yeast strain rather than S288C
Proper citation: RRID:Addgene_115425 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HSP104
Vector Backbone Description: Backbone Size:4895; Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14978213
Proper citation: RRID:Addgene_1155 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HSP104
Vector Backbone Description: Backbone Size:6018; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14978213
Proper citation: RRID:Addgene_1156 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Rad27
Vector Backbone Description: Vector Backbone:pET24; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_239204 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RFC2
Vector Backbone Description: Vector Backbone:pET11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_239203 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
