Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:saccharomyces cerevisiae (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

4,486 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pGEX4T1-GST-eIF4G1-His6
 
Resource Report
Resource Website 		RRID:Addgene_37231 TIF4631 Saccharomyces cerevisiae Ampicillin PMID:20864040 Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX4t1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pET-DUET-GST-eIF4G1-His6, eIF4E
 
Resource Report
Resource Website 		RRID:Addgene_37232 TIF4631 Saccharomyces cerevisiae Ampicillin PMID:20864040 Backbone Marker:EMD bioscience; Backbone Size:5420; Vector Backbone:pETDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pTYB2-PAB1
 
Resource Report
Resource Website 		RRID:Addgene_37234 PAB1 Saccharomyces cerevisiae Ampicillin PMID:21139564 Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pET21c-eIF4A
 
Resource Report
Resource Website 		RRID:Addgene_37230 TIF1 Saccharomyces cerevisiae Ampicillin PMID:20864040 Backbone Marker:EMD bioscience; Backbone Size:5441; Vector Backbone:pET21c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pRS305:Met3p-mCherry-Tub1
 
Resource Report
Resource Website 		RRID:Addgene_37553 Met3p-mCherry-Tub1 Saccharomyces cerevisiae Ampicillin PMID:19185494 Backbone Size:5504; Vector Backbone:pRS305; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 0
p426-SNR52p-gRNA.CAN1.Y-SUP4t
 
Resource Report
Resource Website
50+ mentions 		RRID:Addgene_43803 CAN1.y gRNA Saccharomyces cerevisiae Ampicillin PMID:23460208 gRNA target sequence GATACGTTCTCTATGGAGGA Backbone Size:5886; Vector Backbone:p426; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:09 61
Atg17-Atg31-Atg29-pST39 (Auto 16)
 
Resource Report
Resource Website 		RRID:Addgene_44174 Atg17 Saccharomyces cerevisiae Ampicillin PMID:23219485 Backbone Size:2800; Vector Backbone:pST39; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin none 2026-08-15 01:15:13 0
pRS406 ATG9-GFP S122D
 
Resource Report
Resource Website 		RRID:Addgene_114667 ATG9 Saccharomyces cerevisiae Ampicillin PMID:27050455 Backbone Size:4297; Vector Backbone:pRS406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin changed serine 122 to aspartic acid 2026-08-15 01:02:25 0
pGALSc104(WT)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_1146 HSP104 Saccharomyces cerevisiae Ampicillin PMID:14978213 Please note that attempts to cut this plasmid and its derivatives with XhoI have failed Backbone Size:5703; Vector Backbone:pLA1 (pRS313:GAL1-10); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:02:24 1
pGALSc104(A509D)
 
Resource Report
Resource Website 		RRID:Addgene_1147 HSP104 Saccharomyces cerevisiae Ampicillin PMID:14978213 Backbone Size:5703; Vector Backbone:pLA1 (pRS313:GAL1-10); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin A509D 2026-08-15 01:02:25 0
pGALSc104(T499I)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_1150 HSP104 Saccharomyces cerevisiae Ampicillin PMID:14978213 Backbone Size:5703; Vector Backbone:pLA1 (pRS313:GAL1-10); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin T499I 2026-08-15 01:02:29 1
pGALSc104(A503V)
 
Resource Report
Resource Website 		RRID:Addgene_1152 HSP104 Saccharomyces cerevisiae Ampicillin PMID:14978213 Backbone Size:5703; Vector Backbone:pLA1 (pRS313:GAL1-10); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin A503V 2026-08-15 01:02:31 0
pRPL28(Q38P) SpHIS5 (pNTI664)
 
Resource Report
Resource Website 		RRID:Addgene_115434 RPL28 Saccharomyces cerevisiae Ampicillin PMID:30908907 Backbone Size:2500; Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Q38P; MfeI site in intron 2026-08-15 01:02:34 0
pRPL28(H39L) SpHIS5 (pNTI665)
 
Resource Report
Resource Website 		RRID:Addgene_115435 RPL28 Saccharomyces cerevisiae Ampicillin PMID:30908907 Backbone Size:2500; Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin H39L; MfeI site in intron 2026-08-15 01:02:33 0
pSec7-iGFPx6
 
Resource Report
Resource Website 		RRID:Addgene_115424 Sec7-iGFPx6 Saccharomyces cerevisiae Ampicillin PMID:30858194 Please note sequence is from JK93da yeast strain rather than S288C Vector Backbone:YIplac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:02:33 0
pSec7-Halox2
 
Resource Report
Resource Website 		RRID:Addgene_115425 Sec7-Halox2 Saccharomyces cerevisiae Ampicillin PMID:30858194 Please note sequence is from JK93da yeast strain rather than S288C Vector Backbone:YIplac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:02:33 0
104b-U1(G217S/T499I)
 
Resource Report
Resource Website 		RRID:Addgene_1155 HSP104 Saccharomyces cerevisiae Ampicillin PMID:14978213 Backbone Size:4895; Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin G217S/T499I 2026-08-15 01:02:34 0
HSP104-b/Leu(WT)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_1156 HSP104 Saccharomyces cerevisiae Ampicillin PMID:14978213 Backbone Size:6018; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:02:36 1
Sc Rad27-pET24
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_239204 Rad27 Saccharomyces cerevisiae Kanamycin Vector Backbone:pET24; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:33:02 1
Sc RFC[2+3+4]-pET
 
Resource Report
Resource Website 		RRID:Addgene_239203 RFC2 Saccharomyces cerevisiae Ampicillin Vector Backbone:pET11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:33:02 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch