Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pGEX4T1-GST-eIF4G1-His6 Resource Report Resource Website |
RRID:Addgene_37231 | TIF4631 | Saccharomyces cerevisiae | Ampicillin | PMID:20864040 | Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX4t1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
pET-DUET-GST-eIF4G1-His6, eIF4E Resource Report Resource Website |
RRID:Addgene_37232 | TIF4631 | Saccharomyces cerevisiae | Ampicillin | PMID:20864040 | Backbone Marker:EMD bioscience; Backbone Size:5420; Vector Backbone:pETDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
pTYB2-PAB1 Resource Report Resource Website |
RRID:Addgene_37234 | PAB1 | Saccharomyces cerevisiae | Ampicillin | PMID:21139564 | Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
pET21c-eIF4A Resource Report Resource Website |
RRID:Addgene_37230 | TIF1 | Saccharomyces cerevisiae | Ampicillin | PMID:20864040 | Backbone Marker:EMD bioscience; Backbone Size:5441; Vector Backbone:pET21c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
pRS305:Met3p-mCherry-Tub1 Resource Report Resource Website |
RRID:Addgene_37553 | Met3p-mCherry-Tub1 | Saccharomyces cerevisiae | Ampicillin | PMID:19185494 | Backbone Size:5504; Vector Backbone:pRS305; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 0 | ||
|
p426-SNR52p-gRNA.CAN1.Y-SUP4t Resource Report Resource Website 50+ mentions |
RRID:Addgene_43803 | CAN1.y gRNA | Saccharomyces cerevisiae | Ampicillin | PMID:23460208 | gRNA target sequence GATACGTTCTCTATGGAGGA | Backbone Size:5886; Vector Backbone:p426; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:09 | 61 | |
|
Atg17-Atg31-Atg29-pST39 (Auto 16) Resource Report Resource Website |
RRID:Addgene_44174 | Atg17 | Saccharomyces cerevisiae | Ampicillin | PMID:23219485 | Backbone Size:2800; Vector Backbone:pST39; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | none | 2026-08-15 01:15:13 | 0 | |
|
pRS406 ATG9-GFP S122D Resource Report Resource Website |
RRID:Addgene_114667 | ATG9 | Saccharomyces cerevisiae | Ampicillin | PMID:27050455 | Backbone Size:4297; Vector Backbone:pRS406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | changed serine 122 to aspartic acid | 2026-08-15 01:02:25 | 0 | |
|
pGALSc104(WT) Resource Report Resource Website 1+ mentions |
RRID:Addgene_1146 | HSP104 | Saccharomyces cerevisiae | Ampicillin | PMID:14978213 | Please note that attempts to cut this plasmid and its derivatives with XhoI have failed | Backbone Size:5703; Vector Backbone:pLA1 (pRS313:GAL1-10); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:24 | 1 | |
|
pGALSc104(A509D) Resource Report Resource Website |
RRID:Addgene_1147 | HSP104 | Saccharomyces cerevisiae | Ampicillin | PMID:14978213 | Backbone Size:5703; Vector Backbone:pLA1 (pRS313:GAL1-10); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | A509D | 2026-08-15 01:02:25 | 0 | |
|
pGALSc104(T499I) Resource Report Resource Website 1+ mentions |
RRID:Addgene_1150 | HSP104 | Saccharomyces cerevisiae | Ampicillin | PMID:14978213 | Backbone Size:5703; Vector Backbone:pLA1 (pRS313:GAL1-10); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | T499I | 2026-08-15 01:02:29 | 1 | |
|
pGALSc104(A503V) Resource Report Resource Website |
RRID:Addgene_1152 | HSP104 | Saccharomyces cerevisiae | Ampicillin | PMID:14978213 | Backbone Size:5703; Vector Backbone:pLA1 (pRS313:GAL1-10); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | A503V | 2026-08-15 01:02:31 | 0 | |
|
pRPL28(Q38P) SpHIS5 (pNTI664) Resource Report Resource Website |
RRID:Addgene_115434 | RPL28 | Saccharomyces cerevisiae | Ampicillin | PMID:30908907 | Backbone Size:2500; Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Q38P; MfeI site in intron | 2026-08-15 01:02:34 | 0 | |
|
pRPL28(H39L) SpHIS5 (pNTI665) Resource Report Resource Website |
RRID:Addgene_115435 | RPL28 | Saccharomyces cerevisiae | Ampicillin | PMID:30908907 | Backbone Size:2500; Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | H39L; MfeI site in intron | 2026-08-15 01:02:33 | 0 | |
|
pSec7-iGFPx6 Resource Report Resource Website |
RRID:Addgene_115424 | Sec7-iGFPx6 | Saccharomyces cerevisiae | Ampicillin | PMID:30858194 | Please note sequence is from JK93da yeast strain rather than S288C | Vector Backbone:YIplac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:33 | 0 | |
|
pSec7-Halox2 Resource Report Resource Website |
RRID:Addgene_115425 | Sec7-Halox2 | Saccharomyces cerevisiae | Ampicillin | PMID:30858194 | Please note sequence is from JK93da yeast strain rather than S288C | Vector Backbone:YIplac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:33 | 0 | |
|
104b-U1(G217S/T499I) Resource Report Resource Website |
RRID:Addgene_1155 | HSP104 | Saccharomyces cerevisiae | Ampicillin | PMID:14978213 | Backbone Size:4895; Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | G217S/T499I | 2026-08-15 01:02:34 | 0 | |
|
HSP104-b/Leu(WT) Resource Report Resource Website 1+ mentions |
RRID:Addgene_1156 | HSP104 | Saccharomyces cerevisiae | Ampicillin | PMID:14978213 | Backbone Size:6018; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:36 | 1 | ||
|
Sc Rad27-pET24 Resource Report Resource Website 1+ mentions |
RRID:Addgene_239204 | Rad27 | Saccharomyces cerevisiae | Kanamycin | Vector Backbone:pET24; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:33:02 | 1 | |||
|
Sc RFC[2+3+4]-pET Resource Report Resource Website |
RRID:Addgene_239203 | RFC2 | Saccharomyces cerevisiae | Ampicillin | Vector Backbone:pET11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:33:02 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.