Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 188 showing 3741 ~ 3760 out of 177,820 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_40854

http://www.addgene.org/40854

Species: Xanthomonas oryzae
Genetic Insert: repeat NH3
Vector Backbone Description: Backbone Size:3013; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline
Defining Citation: PMID:21493687

Proper citation: RRID:Addgene_40854 Copy   


  • RRID:Addgene_40852

http://www.addgene.org/40852

Species: Xanthomonas oryzae
Genetic Insert: repeat NH1
Vector Backbone Description: Backbone Size:3013; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline
Defining Citation: PMID:21493687

Proper citation: RRID:Addgene_40852 Copy   


  • RRID:Addgene_40851

http://www.addgene.org/40851

Species: Drosophila melanogaster
Genetic Insert: let-7–mm14-21
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 mm14-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATAGTCCGTACCTACTACCTCAT as: CTAGATGAGGTAGTAGGTACGGACTAT

Proper citation: RRID:Addgene_40851 Copy   


  • RRID:Addgene_40850

http://www.addgene.org/40850

Species: Drosophila melanogaster
Genetic Insert: let-7–mm15-21
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 mm15-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATAACCCGAACCTACTACCTCAT as: CTAGATGAGGTAGTAGGTTCGGGTTAT

Proper citation: RRID:Addgene_40850 Copy   


  • RRID:Addgene_40847

http://www.addgene.org/40847

Species: Drosophila melanogaster
Genetic Insert: let-7–mm1-8
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 mm1-8 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGAACTATACAACCTAGATGGAGTT as: CTAGAACTCCATCTAGGTTGTATAGTT

Proper citation: RRID:Addgene_40847 Copy   


  • RRID:Addgene_40846

http://www.addgene.org/40846

Species: Drosophila melanogaster
Genetic Insert: let-7–bulge9-15
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 bulge9-15 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGAACTATAGTTGGATCTACCTCAT as: CTAGATGAGGTAGATCCAACTATAGTT

Proper citation: RRID:Addgene_40846 Copy   


  • RRID:Addgene_40845

http://www.addgene.org/40845

Species: Drosophila melanogaster
Genetic Insert: let-7–bulge 9-13
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 bulge 9-13 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGAACTATACATGGATCTACCTCAT as: CTAGATGAGGTAGATCCATGTATAGTT

Proper citation: RRID:Addgene_40845 Copy   


  • RRID:Addgene_40843

http://www.addgene.org/40843

Species: Drosophila melanogaster
Genetic Insert: let-7–seed1-8
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 seed1-8 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATAACACGTTGGCTCTACCTCAT as: CTAGATGAGGTAGAGCCAACGTGTTAT

Proper citation: RRID:Addgene_40843 Copy   


  • RRID:Addgene_40849

http://www.addgene.org/40849

Species: Drosophila melanogaster
Genetic Insert: let-7–mm16-21
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 mm16-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATGACACCAACCTACTACCTCAT as: CTAGATGAGGTAGTAGGTTGGTGTCAT

Proper citation: RRID:Addgene_40849 Copy   


  • RRID:Addgene_40848

http://www.addgene.org/40848

Species: Drosophila melanogaster
Genetic Insert: let-7–Bartel
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 Bartel complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATGATAACAACGATCTACCTCAT as: CTAGATGAGGTAGATCGTTGTTATCAT

Proper citation: RRID:Addgene_40848 Copy   


http://www.addgene.org/40834

Species: Drosophila melanogaster
Genetic Insert: Four target sites perfectly complementary to let-7
Vector Backbone Description: Backbone Marker:Murhpy Lab, Carnegie Institution for Science; Backbone Size:7233; Vector Backbone:pAW; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20558712
Comments: The let-7 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTA GAA CTA TAC AAC CTA CTA CCT CAT CTA GAA CTA TAC AAC CTA CTA CCT CAT as: CTA GAT GAG GTA GTA GGT TGT ATA GTT CTA GAT GAG GTA GTA GGT TGT ATA GTT This expression cassette was then sub-cloned into the Gateway vector pAW using GATEWAY cloning.

Proper citation: RRID:Addgene_40834 Copy   


  • RRID:Addgene_40799

http://www.addgene.org/40799

Species: Mus musculus
Genetic Insert: Dppa2
Vector Backbone Description: Backbone Size:8339; Vector Backbone:FUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22980981

Proper citation: RRID:Addgene_40799 Copy   


http://www.addgene.org/40832

Species: Drosophila melanogaster
Genetic Insert: Two target sites perfectly complementary to miR-1
Vector Backbone Description: Backbone Marker:Murhpy Lab, Carnegie Institution for Science; Backbone Size:7233; Vector Backbone:pAW; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20558712
Comments: The miR-1 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTA GAC TCC ATA CTT CTT TAC ATT CCA TCT AGA CTC CAT ACT TCT TTA CAT TCC AT as: CTA GAT GGA ATG TAA AGA AGT ATG GAG TCT AGA TGG AAT GTA AAG AAG TAT GGA GT This expression cassette was then sub-cloned into the Gateway vector pAW using GATEWAY cloning.

Proper citation: RRID:Addgene_40832 Copy   


  • RRID:Addgene_40798

    This resource has 1+ mentions.

http://www.addgene.org/40798

Species: Mus musculus
Genetic Insert: Esrrb
Vector Backbone Description: Backbone Size:8339; Vector Backbone:FUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22980981

Proper citation: RRID:Addgene_40798 Copy   


http://www.addgene.org/40831

Species: Drosophila melanogaster
Genetic Insert: three sites partially complementary to miR-34
Vector Backbone Description: Backbone Marker:promega; Backbone Size:6273; Vector Backbone:psiCheck-2; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22055293
Comments: The psiCheck-3xmiR-34 sequences were cloned by synthesized dsDNA S: 5'-TCGAGGTGTTGATGCTAAGGTCACTGCCAGTGTTGATGCTAAGGTCACTGCCAGTGTTGATGCTAAGGTCACTGCCAGC AS: 5'-GGCCGCTGGCAGTGACCTTAGCATCAACACTGGCAGTGACCTTAGCATCAACACTGGCAGTGACCTTAGCATCAACACC the triple(3x)-repeated sequence: 5'TGGCAGTGACCTTAGCATCAACAC-3' 3'ACCGTCACTGGAATCGTAGTTGTG-5' pairs with dme-miR-34 (uggcagugugguuagcugguugug) with "seed(red) plus 3' complementary region (blue)" fashion.

Proper citation: RRID:Addgene_40831 Copy   


  • RRID:Addgene_40839

http://www.addgene.org/40839

Species: Drosophila melanogaster
Genetic Insert: let-7–mm19-21
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7–mm19-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATGAATACAACCTACTACCTCAT as: CTAGATGAGGTAGTAGGTTGTATTCAT

Proper citation: RRID:Addgene_40839 Copy   


  • RRID:Addgene_40837

http://www.addgene.org/40837

Species: Drosophila melanogaster
Genetic Insert: let-7–mm21
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 mm21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATCTATACAACCTACTACCTCAT as: CTAGATGAGGTAGTAGGTTGTATAGAT

Proper citation: RRID:Addgene_40837 Copy   


  • RRID:Addgene_40825

    This resource has 10+ mentions.

http://www.addgene.org/40825

Species: Homo sapiens
Genetic Insert: SNCA
Vector Backbone Description: Backbone Marker:Roche; Backbone Size:5450; Vector Backbone:pHM6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10698681

Proper citation: RRID:Addgene_40825 Copy   


  • RRID:Addgene_40824

    This resource has 10+ mentions.

http://www.addgene.org/40824

Species: Homo sapiens
Genetic Insert: SNCA
Vector Backbone Description: Backbone Marker:Roche; Backbone Size:5450; Vector Backbone:pHM6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10698681

Proper citation: RRID:Addgene_40824 Copy   


  • RRID:Addgene_40822

    This resource has 10+ mentions.

http://www.addgene.org/40822

Species: Homo sapiens
Genetic Insert: SNCA
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10698681
Comments: Please note that EcoRI is not a unique site. The alpha-synuclein insert contains an EcoRI site in the coding sequence.

Proper citation: RRID:Addgene_40822 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X