Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 188 showing 3741 ~ 3760 out of 177,820 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_59016

http://www.addgene.org/59016

Species: Synthetic
Genetic Insert: NES-ZapCY2 genetically encoded cytosolic Zn(II) sensor
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23992616
Comments: Genetically encoded, ratiometric, fluorescent biosensor. Contains nuclear exclusion signal sequence at N-terminus. Zn(II)-binding domain derived from the first 2 zinc fingers of Zap 1 from Saccharomyces cerevisiae. Contains truncated CFP and Citrine fluorescent proteins. The Zn(II) binding domain of ZapCY2 is derived from ZapCY1. The first cysteine in each zinc finger is mutated to histidine.

Proper citation: RRID:Addgene_59016 Copy   


  • RRID:Addgene_59015

http://www.addgene.org/59015

Species: Synthetic
Genetic Insert: NES-ZapCmR2 genetically encoded cytosolic Zn(II) sensor
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23173058
Comments: Genetically encoded, ratiometric, fluorescent biosensor. Contains nuclear exclusion signal sequence at N-terminus. Zn(II)-binding domain derived from the first 2 zinc fingers of Zap 1 from Saccharomyces cerevisiae. Contains Clover and mRuby fluorescent proteins. The Zn(II) binding domain of ZapCmR2 is derived from ZapCmR1.1. The first cysteine in the second zinc finger is mutated to histidine.

Proper citation: RRID:Addgene_59015 Copy   


http://www.addgene.org/59010

Species: Synthetic
Genetic Insert: mito-ZifCV1.173 genetically encoded Zn(II) sensor
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22850482
Comments: Genetically encoded, ratiometric, fluorescent biosensor targeted to the mitochondria. mito-ZifCV1.173 contains 4 tandem repeats of the first 29 aa of human cox subunit 8a (MSVLTPLLLRGLTGSARRLPVPRAKIHSL). HindIII restriction sites are at the 5' and 3' ends of the mitochondrial targeting sequence. Zn(II)-binding domain derived from mammalian Zif268. Contains truncated CFP and circularly permuted Venus 173.

Proper citation: RRID:Addgene_59010 Copy   


  • RRID:Addgene_59131

http://www.addgene.org/59131

Species: Gallus gallus
Genetic Insert: Focal Adhesion Kinase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3777; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23393139
Comments: Discrepancies between QC and full sequence are of no functional consequence

Proper citation: RRID:Addgene_59131 Copy   


  • RRID:Addgene_59130

http://www.addgene.org/59130

Species: Gallus gallus
Genetic Insert: Focal Adhesion Kinase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3777; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23393139

Proper citation: RRID:Addgene_59130 Copy   


http://www.addgene.org/59133

Genetic Insert: Nuclear-localized Enhanced Yellow Fluorescent Protein
Vector Backbone Description: Backbone Marker:OTTC/NIDA; Vector Backbone:pOTTC476; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28380331

Proper citation: RRID:Addgene_59133 Copy   


  • RRID:Addgene_59011

http://www.addgene.org/59011

Species: Synthetic
Genetic Insert: NLS-ZapCmR1.1 genetically encoded Zn(II) sensor
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23173058
Comments: Genetically encoded, ratiometric, fluorescent biosensor. Contains NLS sequence at N-terminus. Zn(II)-binding domain derived from the first 2 zinc fingers of Zap 1 from Saccharomyces cerevisiae. Contains Clover and mRuby fluorescent proteins. The Zn(II) binding domain of ZapCmR1.1 is derived from ZapCY1. The first cysteine in the first zinc finger is mutated to histidine.

Proper citation: RRID:Addgene_59011 Copy   


http://www.addgene.org/59132

Genetic Insert: Nuclear-localized Infrared Fluorescent Protein
Vector Backbone Description: Backbone Marker:OTTC/NIDA; Vector Backbone:pOTTC475; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28380331

Proper citation: RRID:Addgene_59132 Copy   


  • RRID:Addgene_58972

    This resource has 1+ mentions.

http://www.addgene.org/58972

Species: Homo sapiens
Genetic Insert: Oct4
Vector Backbone Description: Backbone Marker:Dowdy lab; Vector Backbone:T7-VEE-IRES-puro (Addgene plasmid 58970); Vector Types:Mammalian Expression, Venezuelan equine encephalitis (VEE) virus RNA replicon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23910086
Comments: Summary of features: 1-7561: VEE RNA replicases (nsP1, nsP2, nsP3, nsP4 and 26S promoter, nsP1~4 are nonstructural VEE sequences which encode RNA replicases) 7592-8671: human Oct4 8678-8731: T2A peptide sequence 8738-10147: human Klf4 10154-10213: E2A peptide sequence 10223-11176: human Sox2 11195-11805: IRES sequence 11818-13140: human cMyc 13165-13776: IRES sequence 13777-14376: Puromycin resistance gene 14383-14510:VEE 3’UTR and poly A tail 14679-15539: Ampicillin resistance gene 16319-16336: T7 promoter

Proper citation: RRID:Addgene_58972 Copy   


  • RRID:Addgene_58971

    This resource has 1+ mentions.

http://www.addgene.org/58971

Vector Backbone Description: Backbone Marker:gift from I. Frolov; Backbone Size:10793; Vector Backbone:VEE backbone; Vector Types:Mammalian Expression, Venezuelan equine encephalitis (VEE) virus RNA replicon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23910086

Proper citation: RRID:Addgene_58971 Copy   


  • RRID:Addgene_59026

    This resource has 50+ mentions.

http://www.addgene.org/59026

Species: Synthetic
Genetic Insert: AAVS1-TALEN-R
Vector Backbone Description: Backbone Marker:Feng Zhang Lab; Backbone Size:7961; Vector Backbone:pTALEN; Vector Types:Mammalian Expression, AAV, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24931489

Proper citation: RRID:Addgene_59026 Copy   


  • RRID:Addgene_58973

http://www.addgene.org/58973

Species: Homo sapiens
Genetic Insert: Oct4
Vector Backbone Description: Backbone Marker:Dowdy lab; Vector Backbone:SP6-VEE-IRES-puro (Addgene plasmid 58971); Vector Types:Mammalian Expression, Venezuelan equine encephalitis (VEE) virus RNA replicon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23910086
Comments: Summary of features: 1-7561: VEE RNA replicases (nsP1, nsP2, nsP3, nsP4 and 26S promoter, nsP1~4 are nonstructural VEE sequences which encode RNA replicases) 7592-8671: human Oct4 8678-8731: T2A peptide sequence 8738-10147: human Klf4 10154-10213: E2A peptide sequence 10223-11176: human Sox2 11195-11805: IRES sequence 11818-13140: human cMyc 13165-13776: IRES sequence 13777-14376: Puromycin resistance gene 14383-14510:VEE 3’UTR and poly A tail 14679-15539: Ampicillin resistance gene 16320-16337: SP6 promoter

Proper citation: RRID:Addgene_58973 Copy   


  • RRID:Addgene_58976

    This resource has 1+ mentions.

http://www.addgene.org/58976

Species: Aequorea victoria
Genetic Insert: EGFP
Vector Backbone Description: Backbone Marker:Dowdy lab; Vector Backbone:Sp6-VEE-IRES-puro (Addgene plasmid 58971); Vector Types:Mammalian Expression, Venezuelan equine encephalitis (VEE) virus RNA replicon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23910086
Comments: For author-annotated map, please see T7-VEE-GFP (Addgene plasmid 58977).

Proper citation: RRID:Addgene_58976 Copy   


  • RRID:Addgene_58975

http://www.addgene.org/58975

Species: Homo sapiens
Genetic Insert: Oct4
Vector Backbone Description: Backbone Marker:Dowdy lab; Vector Backbone:SP6-VEE-IRES-puro (Addgene plasmid 58971); Vector Types:Mammalian Expression, Venezuelan equine encephalitis (VEE) virus RNA replicon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23910086
Comments: Summary of features: 1-7561: VEE RNA replicases (nsP1, nsP2, nsP3, nsP4 and 26S promoter) 7592-8671: human Oct4 8678-8731: T2A peptide sequence 8738-10147: human Klf4 10154-10213: E2A peptide sequence 10223-11176: human Sox2 11195-11805: IRES sequence 11818-13680: human Glis1 13689-14300: IRES sequence 14301-14900: Puromycin resistance gene 14907-15034: VEE 3’UTR and poly A tail 15203-16063: Ampicillin resistance gene 16844-16861: SP6 promoter

Proper citation: RRID:Addgene_58975 Copy   


  • RRID:Addgene_58982

http://www.addgene.org/58982

Species: Caenorhabditis elegans
Genetic Insert: avr-15 sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24879462
Comments: gRNA target sequence GTTTGCAATATAAGTCACCC

Proper citation: RRID:Addgene_58982 Copy   


  • RRID:Addgene_59037

    This resource has 1+ mentions.

http://www.addgene.org/59037

Species: Homo sapiens
Genetic Insert: CAMSAP2
Vector Backbone Description: Vector Backbone:pFasBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24706919

Proper citation: RRID:Addgene_59037 Copy   


  • RRID:Addgene_59039

    This resource has 1+ mentions.

http://www.addgene.org/59039

Species: Homo sapiens
Genetic Insert: CAMSAP2 CC+CKK domains
Vector Backbone Description: Vector Backbone:pFasBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24706919

Proper citation: RRID:Addgene_59039 Copy   


  • RRID:Addgene_58987

    This resource has 1+ mentions.

http://www.addgene.org/58987

Species: Mus musculus
Genetic Insert: Mouse IRF4
Vector Backbone Description: Vector Backbone:MIG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25006123

Proper citation: RRID:Addgene_58987 Copy   


http://www.addgene.org/59032

Species: Homo sapiens
Genetic Insert: CAMSAP2 CKK domain
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24706919

Proper citation: RRID:Addgene_59032 Copy   


http://www.addgene.org/59031

Species: Homo sapiens
Genetic Insert: CAMSAP1 CKK domain
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24706919

Proper citation: RRID:Addgene_59031 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X