Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: NES-ZapCY2 genetically encoded cytosolic Zn(II) sensor
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23992616
Comments: Genetically encoded, ratiometric, fluorescent biosensor. Contains nuclear exclusion signal sequence at N-terminus. Zn(II)-binding domain derived from the first 2 zinc fingers of Zap 1 from Saccharomyces cerevisiae. Contains truncated CFP and Citrine fluorescent proteins.
The Zn(II) binding domain of ZapCY2 is derived from ZapCY1. The first cysteine in each zinc finger is mutated to histidine.
Proper citation: RRID:Addgene_59016 Copy
Species: Synthetic
Genetic Insert: NES-ZapCmR2 genetically encoded cytosolic Zn(II) sensor
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23173058
Comments: Genetically encoded, ratiometric, fluorescent biosensor. Contains nuclear exclusion signal sequence at N-terminus. Zn(II)-binding domain derived from the first 2 zinc fingers of Zap 1 from Saccharomyces cerevisiae. Contains Clover and mRuby fluorescent proteins.
The Zn(II) binding domain of ZapCmR2 is derived from ZapCmR1.1. The first cysteine in the second zinc finger is mutated to histidine.
Proper citation: RRID:Addgene_59015 Copy
Species: Synthetic
Genetic Insert: mito-ZifCV1.173 genetically encoded Zn(II) sensor
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22850482
Comments: Genetically encoded, ratiometric, fluorescent biosensor targeted to the mitochondria. mito-ZifCV1.173 contains 4 tandem repeats of the first 29 aa of human cox subunit 8a (MSVLTPLLLRGLTGSARRLPVPRAKIHSL). HindIII restriction sites are at the 5' and 3' ends of the mitochondrial targeting sequence. Zn(II)-binding domain derived from mammalian Zif268. Contains truncated CFP and circularly permuted Venus 173.
Proper citation: RRID:Addgene_59010 Copy
Species: Gallus gallus
Genetic Insert: Focal Adhesion Kinase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3777; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23393139
Comments: Discrepancies between QC and full sequence are of no functional consequence
Proper citation: RRID:Addgene_59131 Copy
Species: Gallus gallus
Genetic Insert: Focal Adhesion Kinase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3777; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23393139
Proper citation: RRID:Addgene_59130 Copy
Genetic Insert: Nuclear-localized Enhanced Yellow Fluorescent Protein
Vector Backbone Description: Backbone Marker:OTTC/NIDA; Vector Backbone:pOTTC476; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28380331
Proper citation: RRID:Addgene_59133 Copy
Species: Synthetic
Genetic Insert: NLS-ZapCmR1.1 genetically encoded Zn(II) sensor
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23173058
Comments: Genetically encoded, ratiometric, fluorescent biosensor. Contains NLS sequence at N-terminus. Zn(II)-binding domain derived from the first 2 zinc fingers of Zap 1 from Saccharomyces cerevisiae. Contains Clover and mRuby fluorescent proteins.
The Zn(II) binding domain of ZapCmR1.1 is derived from ZapCY1. The first cysteine in the first zinc finger is mutated to histidine.
Proper citation: RRID:Addgene_59011 Copy
Genetic Insert: Nuclear-localized Infrared Fluorescent Protein
Vector Backbone Description: Backbone Marker:OTTC/NIDA; Vector Backbone:pOTTC475; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28380331
Proper citation: RRID:Addgene_59132 Copy
Species: Homo sapiens
Genetic Insert: Oct4
Vector Backbone Description: Backbone Marker:Dowdy lab; Vector Backbone:T7-VEE-IRES-puro (Addgene plasmid 58970); Vector Types:Mammalian Expression, Venezuelan equine encephalitis (VEE) virus RNA replicon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23910086
Comments: Summary of features:
1-7561: VEE RNA replicases (nsP1, nsP2, nsP3, nsP4 and 26S promoter, nsP1~4 are nonstructural VEE sequences which encode RNA replicases)
7592-8671: human Oct4
8678-8731: T2A peptide sequence
8738-10147: human Klf4
10154-10213: E2A peptide sequence
10223-11176: human Sox2
11195-11805: IRES sequence
11818-13140: human cMyc
13165-13776: IRES sequence
13777-14376: Puromycin resistance gene
14383-14510:VEE 3’UTR and poly A tail
14679-15539: Ampicillin resistance gene
16319-16336: T7 promoter
Proper citation: RRID:Addgene_58972 Copy
Vector Backbone Description: Backbone Marker:gift from I. Frolov; Backbone Size:10793; Vector Backbone:VEE backbone; Vector Types:Mammalian Expression, Venezuelan equine encephalitis (VEE) virus RNA replicon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23910086
Proper citation: RRID:Addgene_58971 Copy
Species: Synthetic
Genetic Insert: AAVS1-TALEN-R
Vector Backbone Description: Backbone Marker:Feng Zhang Lab; Backbone Size:7961; Vector Backbone:pTALEN; Vector Types:Mammalian Expression, AAV, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24931489
Proper citation: RRID:Addgene_59026 Copy
Species: Homo sapiens
Genetic Insert: Oct4
Vector Backbone Description: Backbone Marker:Dowdy lab; Vector Backbone:SP6-VEE-IRES-puro (Addgene plasmid 58971); Vector Types:Mammalian Expression, Venezuelan equine encephalitis (VEE) virus RNA replicon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23910086
Comments: Summary of features:
1-7561: VEE RNA replicases (nsP1, nsP2, nsP3, nsP4 and 26S promoter, nsP1~4 are nonstructural VEE sequences which encode RNA replicases)
7592-8671: human Oct4
8678-8731: T2A peptide sequence
8738-10147: human Klf4
10154-10213: E2A peptide sequence
10223-11176: human Sox2
11195-11805: IRES sequence
11818-13140: human cMyc
13165-13776: IRES sequence
13777-14376: Puromycin resistance gene
14383-14510:VEE 3’UTR and poly A tail
14679-15539: Ampicillin resistance gene
16320-16337: SP6 promoter
Proper citation: RRID:Addgene_58973 Copy
Species: Aequorea victoria
Genetic Insert: EGFP
Vector Backbone Description: Backbone Marker:Dowdy lab; Vector Backbone:Sp6-VEE-IRES-puro (Addgene plasmid 58971); Vector Types:Mammalian Expression, Venezuelan equine encephalitis (VEE) virus RNA replicon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23910086
Comments: For author-annotated map, please see T7-VEE-GFP (Addgene plasmid 58977).
Proper citation: RRID:Addgene_58976 Copy
Species: Homo sapiens
Genetic Insert: Oct4
Vector Backbone Description: Backbone Marker:Dowdy lab; Vector Backbone:SP6-VEE-IRES-puro (Addgene plasmid 58971); Vector Types:Mammalian Expression, Venezuelan equine encephalitis (VEE) virus RNA replicon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23910086
Comments: Summary of features:
1-7561: VEE RNA replicases (nsP1, nsP2, nsP3, nsP4 and 26S promoter)
7592-8671: human Oct4
8678-8731: T2A peptide sequence
8738-10147: human Klf4
10154-10213: E2A peptide sequence
10223-11176: human Sox2
11195-11805: IRES sequence
11818-13680: human Glis1
13689-14300: IRES sequence
14301-14900: Puromycin resistance gene
14907-15034: VEE 3’UTR and poly A tail
15203-16063: Ampicillin resistance gene
16844-16861: SP6 promoter
Proper citation: RRID:Addgene_58975 Copy
Species: Caenorhabditis elegans
Genetic Insert: avr-15 sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24879462
Comments: gRNA target sequence GTTTGCAATATAAGTCACCC
Proper citation: RRID:Addgene_58982 Copy
Species: Homo sapiens
Genetic Insert: CAMSAP2
Vector Backbone Description: Vector Backbone:pFasBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24706919
Proper citation: RRID:Addgene_59037 Copy
Species: Homo sapiens
Genetic Insert: CAMSAP2 CC+CKK domains
Vector Backbone Description: Vector Backbone:pFasBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24706919
Proper citation: RRID:Addgene_59039 Copy
Species: Mus musculus
Genetic Insert: Mouse IRF4
Vector Backbone Description: Vector Backbone:MIG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25006123
Proper citation: RRID:Addgene_58987 Copy
Species: Homo sapiens
Genetic Insert: CAMSAP2 CKK domain
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24706919
Proper citation: RRID:Addgene_59032 Copy
Species: Homo sapiens
Genetic Insert: CAMSAP1 CKK domain
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24706919
Proper citation: RRID:Addgene_59031 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.