Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: anti-Gephyrin (Homo sapiens) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2916208. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_188192 Copy
Species: Mus musculus
Genetic Insert: anti-Cav1.2 Ca2+ channel phosphorylation site pS1928 (Rat) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2916225. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_188193 Copy
Species: Mus musculus
Genetic Insert: anti-PSD-95 (Homo sapiens) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2916197. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_188195 Copy
Species: Mus musculus
Genetic Insert: anti-PSD-95 (Homo sapiens) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2916199. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_188197 Copy
Species: Mus musculus
Genetic Insert: tdTomato-T2A-mSyp::EGFP
Vector Backbone Description: Backbone Marker:Connie Cepko (Addgene plasmid # 13769); Backbone Size:6107; Vector Backbone:pCALNL; Vector Types:Mammalian Expression, pCAGEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36386881
Comments: Suggested primers to sequence the insert:
5' ccttcttgacgagttcttctg 3'
5' acgtctccgcatgtcagaag 3'
5' aaggcctgtccgatgtgaag 3'
5' ttcaggaagccaaacaccac 3'
5' GCTTGCCGTAGGTGGCATC 3'
5' CAGGAAACAGCTATGAC 3'
Proper citation: RRID:Addgene_191213 Copy
Species: Mus musculus
Genetic Insert: 3'UTR mMov10
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3560; Vector Backbone:psiCHECK-2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35856394
Comments: Please visit https://doi.org/10.1101/2021.11.09.467897 for bioRxiv preprint.
Proper citation: RRID:Addgene_178910 Copy
Species: Mus musculus
Genetic Insert: Cdk2ap1
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression, Nonviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34644528
Proper citation: RRID:Addgene_178033 Copy
Species: Mus musculus
Genetic Insert: mTurquoise2
Vector Backbone Description: Backbone Marker:Knouse Lab; Vector Backbone:pLentiCRISPRv2-Stuffer-HepmTurquoise2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36643909
Proper citation: RRID:Addgene_192828 Copy
Species: Mus musculus
Genetic Insert: mD6Ertd527e
Vector Backbone Description: Backbone Size:2886; Vector Backbone:pSV40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36482406
Proper citation: RRID:Addgene_192223 Copy
Species: Mus musculus
Genetic Insert: Cdk2ap1
Vector Backbone Description: Backbone Marker:David Bartel; Backbone Size:7657; Vector Backbone:pMSCV PIG (Puro IRES GFP empty vector); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34644528
Proper citation: RRID:Addgene_178031 Copy
Species: Mus musculus
Genetic Insert: Mouse Liver CRISPR Knockout Library
Vector Backbone Description: Vector Backbone:pLentiCRISPRv2-Stuffer-HepmCherry; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36643909
Proper citation: RRID:Addgene_192824 Copy
Species: Mus musculus
Genetic Insert: Vamp2
Vector Backbone Description: Backbone Marker:Zuchero lab; Backbone Size:4561; Vector Backbone:pBZ-167 AAV CMV promoter base vector; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36151203
Comments: Uribina...& Gupton; PMID: 29351997
Gow...& Lazzarini; PMID:1383235
Pan... & Musacchio; PMID: 28059702.
Please visit https://www.biorxiv.org/content/10.1101/2022.07.08.498895v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_190153 Copy
Species: Mus musculus
Genetic Insert: Vamp2
Vector Backbone Description: Backbone Marker:Zuchero lab; Vector Backbone:pBZ-167 AAV CMV promoter base vector; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36151203
Comments: Vamp2-pHluorin was cloned from a construct kindly provided by Prof. Stephanie Gupton, from this paper: PMID: 29351997.
Please visit https://www.biorxiv.org/content/10.1101/2022.07.08.498895v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_190151 Copy
Species: Mus musculus
Genetic Insert: SspBmicro-mCherry-p60
Vector Backbone Description: Backbone Marker:Lukas Kapitein lab; Backbone Size:6000; Vector Backbone:pB80; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36174574
Proper citation: RRID:Addgene_190168 Copy
Species: Mus musculus
Genetic Insert: VP2C-GFPdeg
Vector Backbone Description: Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin
Comments: VP1 has 63 residues removed from the C-terminal. This abolishes in-vivo assembly in yeast.
Please visit https://www.biorxiv.org/content/10.1101/2022.11.24.517869v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_182481 Copy
Species: Mus musculus
Genetic Insert: miREgr3-5D
Vector Backbone Description: Backbone Marker:Bryan Roth; Backbone Size:6181; Vector Backbone:pAAV-hSyn-DIO-IRES-mCitrine; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25995477
Proper citation: RRID:Addgene_186419 Copy
Species: Mus musculus
Genetic Insert: Mcm2-2A mutation sgRNA
Vector Backbone Description: Backbone Size:9174; Vector Backbone:px459; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35523900
Proper citation: RRID:Addgene_186936 Copy
Species: Mus musculus
Genetic Insert: Pole4 KO sgRNA
Vector Backbone Description: Backbone Size:9174; Vector Backbone:px459; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35523900
Proper citation: RRID:Addgene_186935 Copy
Species: Mus musculus
Genetic Insert: KASH2
Vector Backbone Description: Vector Backbone:pPB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31844279
Comments: Inducible construct via doxycycline addition
Proper citation: RRID:Addgene_187017 Copy
Species: Mus musculus
Genetic Insert: SS-HA-Sun1L-KDEL
Vector Backbone Description: Vector Backbone:pCDH; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21652697
Proper citation: RRID:Addgene_187016 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
