Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 189 showing 3761 ~ 3780 out of 740,017 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_58981

http://www.addgene.org/58981

Species: Caenorhabditis elegans
Genetic Insert: avr-14 sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24879462
Comments: gRNA target sequence GATTGGAGAGTTAGACCACG

Proper citation: RRID:Addgene_58981 Copy   


  • RRID:Addgene_58980

    This resource has 1+ mentions.

http://www.addgene.org/58980

Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:4872; Vector Backbone:pUG35; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26184437

Proper citation: RRID:Addgene_58980 Copy   


http://www.addgene.org/59048

Species: Drosophila melanogaster
Genetic Insert: Patronin
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pENTR; Vector Types:Bacterial Expression, Insect Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24706919

Proper citation: RRID:Addgene_59048 Copy   


  • RRID:Addgene_58996

    This resource has 1+ mentions.

http://www.addgene.org/58996

Species: Synthetic
Genetic Insert: mito-ZapCY1 high affinity Zn(II) sensor
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22850482
Comments: Genetically encoded, ratiometric, fluorescent biosensor. mito-ZapCY1 contains 4 tandem repeats of the first 29 aa of human cox subunit 8a (MSVLTPLLLRGLTGSARRLPVPRAKIHSL). HindIII restriction sites are at the 5' and 3' ends of the mitochondrial targeting sequence. Zn(II)-binding domain derived from the first 2 zinc fingers of Zap 1 from Saccharomyces cerevisiae. Contains truncated CFP and Citrine fluorescent proteins.

Proper citation: RRID:Addgene_58996 Copy   


http://www.addgene.org/59040

Species: Homo sapiens
Genetic Insert: CAMSAP2 CC domain
Vector Backbone Description: Vector Backbone:pFasBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24706919

Proper citation: RRID:Addgene_59040 Copy   


  • RRID:Addgene_58914

    This resource has 1+ mentions.

http://www.addgene.org/58914

Species: Homo sapiens
Genetic Insert: Rb
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24876129
Comments: *CDK mutations (all changed to Ala): T5, S239, S249, T252, T356, T373, S608, S612, S780, S788, S795, S807, S811, T821, T826

Proper citation: RRID:Addgene_58914 Copy   


  • RRID:Addgene_58918

    This resource has 1+ mentions.

http://www.addgene.org/58918

Species: Homo sapiens
Genetic Insert: Rb
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24876129
Comments: *CDK mutations (all changed to Ala): T5, S239, S249, T252, T356, T373, S608, S612, S780, S788, S795, S807, S811, T821, T826

Proper citation: RRID:Addgene_58918 Copy   


http://www.addgene.org/58920

Species: Homo sapiens
Genetic Insert: Rb
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24876129
Comments: *CDK mutations (all changed to Ala): T5, S239, S249, T252, T356, T373, S608, S612, S780, S788, S795, S807, S811, T821, T826

Proper citation: RRID:Addgene_58920 Copy   


http://www.addgene.org/59053

Species: Drosophila melanogaster
Genetic Insert: Patronin
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24706919

Proper citation: RRID:Addgene_59053 Copy   


  • RRID:Addgene_59056

    This resource has 1+ mentions.

http://www.addgene.org/59056

Species: Stigeoclonium helveticum
Genetic Insert: Chronos-GFP
Vector Backbone Description: Backbone Marker:Addgene (Plasmid 11159); Backbone Size:5117; Vector Backbone:pCAGIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24509633
Comments: The depositing lab sequenced this plasmid completely except for the CAG promoter.

Proper citation: RRID:Addgene_59056 Copy   


http://www.addgene.org/59055

Species: Drosophila melanogaster
Genetic Insert: Patronin
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24706919

Proper citation: RRID:Addgene_59055 Copy   


http://www.addgene.org/58924

Species: Mus musculus
Genetic Insert: mitogen-activated protein kinase 8 interacting protein 3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcdna3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10629060

Proper citation: RRID:Addgene_58924 Copy   


http://www.addgene.org/58928

Species: Mus musculus
Genetic Insert: Mapk8ip4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcdna3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15767678

Proper citation: RRID:Addgene_58928 Copy   


http://www.addgene.org/58934

Species: Danio rerio
Genetic Insert: mcherry-2a-Rac2D57N
Vector Backbone Description: Backbone Size:3500; Vector Backbone:Tol2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22014524

Proper citation: RRID:Addgene_58934 Copy   


  • RRID:Addgene_59070

    This resource has 10+ mentions.

http://www.addgene.org/59070

Species: Chloromonas oogama
Genetic Insert: CoChR-GFP
Vector Backbone Description: Backbone Size:4368; Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24509633
Comments: Plasmid is completely sequenced by the depositing lab except for part of the 3' ITR. Addgene QC NGS analysis identifies ambiguous bases following the 3' ITR. It is unknown what, if any, impact this may have on plasmid function.

Proper citation: RRID:Addgene_59070 Copy   


  • RRID:Addgene_58935

    This resource has 1+ mentions.

http://www.addgene.org/58935

Genetic Insert: mpeg1-mcherry
Vector Backbone Description: Backbone Size:3500; Vector Backbone:Tol2; Vector Types:; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_58935 Copy   


  • RRID:Addgene_59119

http://www.addgene.org/59119

Species: Gallus gallus
Genetic Insert: Focal Adhesion Kinase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5002; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23393139
Comments: Discrepancies between QC and full sequence are of no functional consequence

Proper citation: RRID:Addgene_59119 Copy   


  • RRID:Addgene_58948

http://www.addgene.org/58948

Species: Danio rerio
Genetic Insert: Kit receptor a mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20525357

Proper citation: RRID:Addgene_58948 Copy   


  • RRID:Addgene_59126

http://www.addgene.org/59126

Species: Gallus gallus
Genetic Insert: Focal Adhesion Kinase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5002; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23393139
Comments: Discrepancies between QC and full sequence are of no functional consequence

Proper citation: RRID:Addgene_59126 Copy   


  • RRID:Addgene_59125

http://www.addgene.org/59125

Species: Gallus gallus
Genetic Insert: Focal Adhesion Kinase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5002; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23393139
Comments: Discrepancies between QC and full sequence are of no functional consequence

Proper citation: RRID:Addgene_59125 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X