Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:homo sapiens (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

69,553 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pPHR-mCherry-hNPM
 
Resource Report
Resource Website 		RRID:Addgene_181887 PHR-mCherry-hNPM Homo sapiens Kanamycin PMID:32101700 cloned hNPM into pPHR-mCherry Vector via XbaI/SalI Backbone Marker:Clontech; Backbone Size:3958; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:11:29 0
CFP-CD82
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_1818 CD82 Homo sapiens Kanamycin PMID:14617360 Backbone Marker:BD Biosciences / Clontech; Backbone Size:4700; Vector Backbone:pECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:11:29 2
YFP-CD82
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_1819 CD82 Homo sapiens Kanamycin PMID:14617360 Backbone Marker:BD Biosciences / Clontech; Backbone Size:4700; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:11:29 2
Phage-PGK-Flag-HA-FKBP-T(G177D)
 
Resource Report
Resource Website 		RRID:Addgene_181735 T (brachyury) Homo sapiens Ampicillin PMID:33521702 Vector Backbone:Phage-PGK-Flag-HA-FKBP-DEST; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin a silent mutation in the PAM site of an sgRNAt targeting enodgenous T (sg_T: CCCTGAGACCCAGTTCATAG) at amino acid 194 - C to T at position 3 of alanine. Also a G to A mutation at position 2 of Glycine 177. 2026-08-15 01:11:28 0
Phage-PGK-Flag-HA-FKBP-T(WT)
 
Resource Report
Resource Website 		RRID:Addgene_181734 T (brachyury) Homo sapiens Ampicillin PMID:33521702 Vector Backbone:Phage-PGK-Flag-HA-FKBP-DEST; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin a silent mutation in the PAM site of an sgRNAt targeting enodgenous T (sg_T: CCCTGAGACCCAGTTCATAG) at amino acid 194 - C to T at position 3 of alanine 2026-08-15 01:11:28 0
pAAV-EF1α-DIO-CFL-SN
 
Resource Report
Resource Website 		RRID:Addgene_181740 CFL-SN Homo sapiens Ampicillin PMID:34762472 As descried above, SN was developed by Dr. Takeharu Nagai (Osaka University). https://www.addgene.org/53234/ Backbone Marker:Stratagene; Backbone Size:5604; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:11:28 0
pGFP-hPMLIII
 
Resource Report
Resource Website 		RRID:Addgene_181903 hPMLIII Homo sapiens Kanamycin PMID:32101700 Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:11:29 0
H2B-MiniR-mEm
 
Resource Report
Resource Website 		RRID:Addgene_181990 H2B-MiniR-mEm Homo sapiens Kanamycin PMID:32786411 Backbone Marker:Addgene; Backbone Size:5863; Vector Backbone:mEmerald-H2B-6; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:11:30 0
pCDH1-CMV-HT-LC3-SV40-Hygro
 
Resource Report
Resource Website 		RRID:Addgene_182045 MAP1LC3B Homo sapiens Ampicillin PMID:31519728 Vector Backbone:pCDH1-CMV-MCS-SV40-Hygro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:11:30 0
GST_LIM1334
 
Resource Report
Resource Website 		RRID:Addgene_182040 LIM1334 Homo sapiens Ampicillin PMID:33782527 collaboration project Vector Backbone:pGST-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin LIM domains 1, 3, 3 and 4 2026-08-15 01:11:30 0
MBP_Lims (MBP_LIM1234)
 
Resource Report
Resource Website 		RRID:Addgene_182042 LIM1234 Homo sapiens Ampicillin PMID:33782527 collaboration project Vector Backbone:MBP vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin LIM domains 1-4 only 2026-08-15 01:11:30 0
GST_LIM1224
 
Resource Report
Resource Website 		RRID:Addgene_182041 LIM1224 Homo sapiens Ampicillin PMID:33782527 collaboration project Vector Backbone:pGST-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin LIM domains 1, 2, 2 and 4 2026-08-15 01:11:30 0
mEm-CoilE-Actin
 
Resource Report
Resource Website 		RRID:Addgene_181993 mEm-CoilE-Actin Homo sapiens Kanamycin PMID:30518560 Backbone Marker:Addgene; Backbone Size:6643; Vector Backbone:mEmerald-Actin-C-18; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:11:30 0
H2B-CoilE-mEm
 
Resource Report
Resource Website 		RRID:Addgene_181992 H2B-CoilE-mEm Homo sapiens Kanamycin PMID:30518560 Backbone Marker:Addgene; Backbone Size:5863; Vector Backbone:mEmerald-H2B-6; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:11:30 0
TOMM20-CoilE-mCherry
 
Resource Report
Resource Website 		RRID:Addgene_181995 TOMM20-CoilE-mCherry Homo sapiens Kanamycin PMID:30518560 Backbone Marker:Addgene; Backbone Size:5923; Vector Backbone:mCherry-TOMM20-N-10; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:11:30 0
SIN40C.TRE.HA.RUNX1A.IRES.dTomato.PGK.sfGFP.P2A.Tet3G
 
Resource Report
Resource Website 		RRID:Addgene_181977 RUNX1A (human) Homo sapiens Ampicillin PMID:36493345 Vector Backbone:SIN40C.TRE.IRES.dTomato.PGK.sfGFP.P2A.Tet3G; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:11:29 0
pRRL.PPT.SFFV.HA.RUNX1A.IRES.eGFP
 
Resource Report
Resource Website 		RRID:Addgene_181979 RUNX1A (human) Homo sapiens Ampicillin PMID:36493345 Vector Backbone:pRRL.PPT.SFFV.MCS.IRES.dTomato; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:11:29 0
SIN40C.TRE.HA.RUNX1C.IRES.dTomato.PGK.sfGFP.P2A.Tet3G
 
Resource Report
Resource Website 		RRID:Addgene_181978 RUNX1C (human) Homo sapiens Ampicillin PMID:36493345 Vector Backbone:SIN40C.TRE.IRES.dTomato.PGK.sfGFP.P2A.Tet3G; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:11:29 0
pRRL.PPT.SFFV.HA.RUNX1C.IRES.eGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_181980 RUNX1C (human) Homo sapiens Ampicillin PMID:36493345 Vector Backbone:pRRL.PPT.SFFV.MCS.IRES.dTomato; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:11:29 1
GST_LIM234
 
Resource Report
Resource Website 		RRID:Addgene_182039 LIM234 Homo sapiens Ampicillin PMID:33782527 collaboration project Vector Backbone:pGST-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin LIM domains 2-4 only 2026-08-15 01:11:30 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch