Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pPHR-mCherry-hNPM Resource Report Resource Website |
RRID:Addgene_181887 | PHR-mCherry-hNPM | Homo sapiens | Kanamycin | PMID:32101700 | cloned hNPM into pPHR-mCherry Vector via XbaI/SalI | Backbone Marker:Clontech; Backbone Size:3958; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:11:29 | 0 | |
|
CFP-CD82 Resource Report Resource Website 1+ mentions |
RRID:Addgene_1818 | CD82 | Homo sapiens | Kanamycin | PMID:14617360 | Backbone Marker:BD Biosciences / Clontech; Backbone Size:4700; Vector Backbone:pECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:11:29 | 2 | ||
|
YFP-CD82 Resource Report Resource Website 1+ mentions |
RRID:Addgene_1819 | CD82 | Homo sapiens | Kanamycin | PMID:14617360 | Backbone Marker:BD Biosciences / Clontech; Backbone Size:4700; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:11:29 | 2 | ||
|
Phage-PGK-Flag-HA-FKBP-T(G177D) Resource Report Resource Website |
RRID:Addgene_181735 | T (brachyury) | Homo sapiens | Ampicillin | PMID:33521702 | Vector Backbone:Phage-PGK-Flag-HA-FKBP-DEST; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | a silent mutation in the PAM site of an sgRNAt targeting enodgenous T (sg_T: CCCTGAGACCCAGTTCATAG) at amino acid 194 - C to T at position 3 of alanine. Also a G to A mutation at position 2 of Glycine 177. | 2026-08-15 01:11:28 | 0 | |
|
Phage-PGK-Flag-HA-FKBP-T(WT) Resource Report Resource Website |
RRID:Addgene_181734 | T (brachyury) | Homo sapiens | Ampicillin | PMID:33521702 | Vector Backbone:Phage-PGK-Flag-HA-FKBP-DEST; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | a silent mutation in the PAM site of an sgRNAt targeting enodgenous T (sg_T: CCCTGAGACCCAGTTCATAG) at amino acid 194 - C to T at position 3 of alanine | 2026-08-15 01:11:28 | 0 | |
|
pAAV-EF1α-DIO-CFL-SN Resource Report Resource Website |
RRID:Addgene_181740 | CFL-SN | Homo sapiens | Ampicillin | PMID:34762472 | As descried above, SN was developed by Dr. Takeharu Nagai (Osaka University). https://www.addgene.org/53234/ | Backbone Marker:Stratagene; Backbone Size:5604; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:28 | 0 | |
|
pGFP-hPMLIII Resource Report Resource Website |
RRID:Addgene_181903 | hPMLIII | Homo sapiens | Kanamycin | PMID:32101700 | Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:11:29 | 0 | ||
|
H2B-MiniR-mEm Resource Report Resource Website |
RRID:Addgene_181990 | H2B-MiniR-mEm | Homo sapiens | Kanamycin | PMID:32786411 | Backbone Marker:Addgene; Backbone Size:5863; Vector Backbone:mEmerald-H2B-6; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:11:30 | 0 | ||
|
pCDH1-CMV-HT-LC3-SV40-Hygro Resource Report Resource Website |
RRID:Addgene_182045 | MAP1LC3B | Homo sapiens | Ampicillin | PMID:31519728 | Vector Backbone:pCDH1-CMV-MCS-SV40-Hygro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:30 | 0 | ||
|
GST_LIM1334 Resource Report Resource Website |
RRID:Addgene_182040 | LIM1334 | Homo sapiens | Ampicillin | PMID:33782527 | collaboration project | Vector Backbone:pGST-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | LIM domains 1, 3, 3 and 4 | 2026-08-15 01:11:30 | 0 |
|
MBP_Lims (MBP_LIM1234) Resource Report Resource Website |
RRID:Addgene_182042 | LIM1234 | Homo sapiens | Ampicillin | PMID:33782527 | collaboration project | Vector Backbone:MBP vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | LIM domains 1-4 only | 2026-08-15 01:11:30 | 0 |
|
GST_LIM1224 Resource Report Resource Website |
RRID:Addgene_182041 | LIM1224 | Homo sapiens | Ampicillin | PMID:33782527 | collaboration project | Vector Backbone:pGST-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | LIM domains 1, 2, 2 and 4 | 2026-08-15 01:11:30 | 0 |
|
mEm-CoilE-Actin Resource Report Resource Website |
RRID:Addgene_181993 | mEm-CoilE-Actin | Homo sapiens | Kanamycin | PMID:30518560 | Backbone Marker:Addgene; Backbone Size:6643; Vector Backbone:mEmerald-Actin-C-18; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:11:30 | 0 | ||
|
H2B-CoilE-mEm Resource Report Resource Website |
RRID:Addgene_181992 | H2B-CoilE-mEm | Homo sapiens | Kanamycin | PMID:30518560 | Backbone Marker:Addgene; Backbone Size:5863; Vector Backbone:mEmerald-H2B-6; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:11:30 | 0 | ||
|
TOMM20-CoilE-mCherry Resource Report Resource Website |
RRID:Addgene_181995 | TOMM20-CoilE-mCherry | Homo sapiens | Kanamycin | PMID:30518560 | Backbone Marker:Addgene; Backbone Size:5923; Vector Backbone:mCherry-TOMM20-N-10; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:11:30 | 0 | ||
|
SIN40C.TRE.HA.RUNX1A.IRES.dTomato.PGK.sfGFP.P2A.Tet3G Resource Report Resource Website |
RRID:Addgene_181977 | RUNX1A (human) | Homo sapiens | Ampicillin | PMID:36493345 | Vector Backbone:SIN40C.TRE.IRES.dTomato.PGK.sfGFP.P2A.Tet3G; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:29 | 0 | ||
|
pRRL.PPT.SFFV.HA.RUNX1A.IRES.eGFP Resource Report Resource Website |
RRID:Addgene_181979 | RUNX1A (human) | Homo sapiens | Ampicillin | PMID:36493345 | Vector Backbone:pRRL.PPT.SFFV.MCS.IRES.dTomato; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:29 | 0 | ||
|
SIN40C.TRE.HA.RUNX1C.IRES.dTomato.PGK.sfGFP.P2A.Tet3G Resource Report Resource Website |
RRID:Addgene_181978 | RUNX1C (human) | Homo sapiens | Ampicillin | PMID:36493345 | Vector Backbone:SIN40C.TRE.IRES.dTomato.PGK.sfGFP.P2A.Tet3G; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:29 | 0 | ||
|
pRRL.PPT.SFFV.HA.RUNX1C.IRES.eGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_181980 | RUNX1C (human) | Homo sapiens | Ampicillin | PMID:36493345 | Vector Backbone:pRRL.PPT.SFFV.MCS.IRES.dTomato; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:29 | 1 | ||
|
GST_LIM234 Resource Report Resource Website |
RRID:Addgene_182039 | LIM234 | Homo sapiens | Ampicillin | PMID:33782527 | collaboration project | Vector Backbone:pGST-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | LIM domains 2-4 only | 2026-08-15 01:11:30 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.