Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pX458-IAP-del-gRNA2 Resource Report Resource Website |
RRID:Addgene_185003 | IAP-del-gRNA2 | Mus musculus | Ampicillin | PMID:35864192 | Vector Backbone:PX458; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:11 | 0 | ||
|
pX458-MMETn-del-gRNA1 Resource Report Resource Website |
RRID:Addgene_185006 | MMETn-del-gRNA1 | Mus musculus | Ampicillin | PMID:35864192 | Vector Backbone:PX458; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:11 | 0 | ||
|
pET-45b-mEGFP Resource Report Resource Website |
RRID:Addgene_185013 | Sirius-GFP | Mus musculus | Ampicillin | PMID:35864192 | Vector Backbone:pET-45(b+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:11 | 0 | ||
|
MSCV-Arkadia C946S H948L Resource Report Resource Website |
RRID:Addgene_180373 | Arkadia | Mus musculus | Ampicillin | PMID:34473197 | Plasmid contains Arkadia isoform 3 Please note: Plasmid contains a D454N mutation in Arkadia. This mutation is not known to affect plasmid function. | Backbone Size:6395; Vector Backbone:MSCV-IRES-Thy1.1 DEST; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | C946S H948L | 2026-08-15 01:23:12 | 0 |
|
pMyosin-miRFP670nano3 Resource Report Resource Website |
RRID:Addgene_184668 | miRFP670nano3-LC-Myosin | Mus musculus | Ampicillin | PMID:35606446 | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:12 | 0 | ||
|
pUC19.TRIM28.FKBP.knock-in.mCerulean Resource Report Resource Website |
RRID:Addgene_185009 | FKBP F36V P2A mCerulean | Mus musculus | Ampicillin | PMID:35864192 | Vector Backbone:pUC19; Vector Types:Cloning; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:11 | 0 | ||
|
pX458-MMETn-del-gRNA2 Resource Report Resource Website |
RRID:Addgene_185007 | MMETn-del-gRNA2 | Mus musculus | Ampicillin | PMID:35864192 | Vector Backbone:PX458; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:11 | 0 | ||
|
AAV-CMV-Cyp26a1 Resource Report Resource Website |
RRID:Addgene_185563 | Cyp26a1 | Mus musculus | Ampicillin | PMID:35315776 | Vector Backbone:AAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:13 | 0 | ||
|
TRE-RARa-VP16 Resource Report Resource Website |
RRID:Addgene_185561 | RARa-VP16 | Mus musculus | Ampicillin | PMID:35315776 | Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:13 | 0 | ||
|
Ad:2CMV_A2R2-N25Ctr Resource Report Resource Website |
RRID:Addgene_122243 | C-terminal end of Nesprin-3 w/o Kash | Mus musculus | Kanamycin | PMID:34857921 | Dominant negative Kash construct is comprised of the C-terminal end of Nesprin-3, including the transmembrane but excluding the Kash domain, and fused to Nesprin2.5 for visual location and to the signal peptide of TOR1A (NM_000113.2) for membrane integration. This vector is meant as integration defective control (into LINC complex) for the vector Ad:2CMV_A2R2-N25K3 (122242). Please note the L451V substitution in Actinin alpha 2 has no functional consequences. Please visit https://www.biorxiv.org/content/early/2018/10/29/455600 for BioRxiv preprint. | Backbone Size:7469; Vector Backbone:pShuttle-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin | deleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGGCCAACAACTTCGCCCGCTCCTTTGCGCTCATGCTTCGGTACAATGGCCCCCCGCCCACC) | 2026-08-15 01:23:14 | 0 |
|
pHR_TRE_mcherry-P2A-Pcad Resource Report Resource Website |
RRID:Addgene_133807 | cadherin 3 (CDH3) | Mus musculus | Ampicillin | PMID:29853554 | Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:14 | 0 | ||
|
Nrxn3α-AS4+ Resource Report Resource Website |
RRID:Addgene_184333 | Nrxn3-alpha | Mus musculus | Ampicillin | PMID:27960072 | Backbone Marker:Alice Ting Lab / Addgene_#20861; Vector Backbone:pDisplay-AP-CFP-TM; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:14 | 0 | ||
|
pDisplay-EGFP-2A-HA-Nrxn3-alpha- 2(-)/3(+)/4(+)/6(+) Resource Report Resource Website |
RRID:Addgene_184334 | Nrxn3-alpha | Mus musculus | Ampicillin | PMID:35550065 | Backbone Marker:Alice Ting Lab / Addgene_#20861; Vector Backbone:pDisplay-AP-CFP-TM; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:14 | 0 | ||
|
pAdCMV/V5-DEST-S727A-STAT3-3xFlag Resource Report Resource Website |
RRID:Addgene_99262 | Signal transducer and activator of transcription 3 - S727A | Mus musculus | Ampicillin | PMID:29351406 | *E16K mutation in STAT3 | Backbone Marker:Thermo Fisher; Backbone Size:34621; Vector Backbone:pAdCMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin | S727A | 2026-08-15 01:22:44 | 0 |
|
p2lox-cAMPr Resource Report Resource Website 1+ mentions |
RRID:Addgene_99143 | cAMPr | Mus musculus | Ampicillin | PMID:29511120 | Backbone Marker:Michael Kyba; Backbone Size:2660; Vector Backbone:p2Lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:22:43 | 3 | ||
|
pAdCMV/V5-DEST-STAT3C-3xFlag Resource Report Resource Website 1+ mentions |
RRID:Addgene_99264 | Signal transducer and activator of transcription 3 - constitutive dimer | Mus musculus | Ampicillin | PMID:29351406 | *E16K mutation in STAT3 | Backbone Marker:Thermo Fisher; Backbone Size:34621; Vector Backbone:pAdCMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin | A662C N664C | 2026-08-15 01:22:46 | 2 |
|
pCW57.1-mDux-CA Resource Report Resource Website 1+ mentions |
RRID:Addgene_99284 | Dux-CA (mouse; codon altered) | Mus musculus | Ampicillin | PMID:28459454 | Backbone Size:9354; Vector Backbone:pCW57.1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:22:46 | 7 | ||
|
pET-NCBD + ACTR Resource Report Resource Website |
RRID:Addgene_99335 | CBP NCBD (2059-2117) | Mus musculus | Ampicillin | PMID:11823864 | Backbone Marker:Novagen; Backbone Size:5493; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:22:46 | 0 | ||
|
pET-KIX (586-672) Resource Report Resource Website 1+ mentions |
RRID:Addgene_99336 | CBP KIX (586-672) | Mus musculus | Ampicillin | PMID:10222196 | Backbone Marker:Novaen; Backbone Size:5443; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:22:44 | 1 | ||
|
GST-BRDCH2 (1079-1317) Resource Report Resource Website |
RRID:Addgene_99339 | mouse CBP BRDCH2 (1079-1317) | Mus musculus | Ampicillin | PMID:23831576 | Backbone Marker:NEB; Backbone Size:4970; Vector Backbone:pGEX4T2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:22:47 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
