Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCCM936 Resource Report Resource Website |
RRID:Addgene_58981 | avr-14 sgRNA | Caenorhabditis elegans | Kanamycin | PMID:24879462 | gRNA target sequence GATTGGAGAGTTAGACCACG | Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:20 | 0 | |
|
pMitoLOC Resource Report Resource Website 1+ mentions |
RRID:Addgene_58980 | mCherry | Synthetic | Ampicillin | PMID:26184437 | Backbone Size:4872; Vector Backbone:pUG35; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:20 | 5 | ||
|
pENTR-GFP-Patronin CC+CKK Resource Report Resource Website |
RRID:Addgene_59048 | Patronin | Drosophila melanogaster | Kanamycin | PMID:24706919 | Backbone Marker:Invitrogen; Vector Backbone:pENTR; Vector Types:Bacterial Expression, Insect Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:20 | 0 | ||
|
pcDNA-mito-ZapCY1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_58996 | mito-ZapCY1 high affinity Zn(II) sensor | Synthetic | Ampicillin | PMID:22850482 | Genetically encoded, ratiometric, fluorescent biosensor. mito-ZapCY1 contains 4 tandem repeats of the first 29 aa of human cox subunit 8a (MSVLTPLLLRGLTGSARRLPVPRAKIHSL). HindIII restriction sites are at the 5' and 3' ends of the mitochondrial targeting sequence. Zn(II)-binding domain derived from the first 2 zinc fingers of Zap 1 from Saccharomyces cerevisiae. Contains truncated CFP and Citrine fluorescent proteins. | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:20 | 2 | |
|
pFasBac+GFP-CAMSAP2 CC Resource Report Resource Website |
RRID:Addgene_59040 | CAMSAP2 CC domain | Homo sapiens | Ampicillin | PMID:24706919 | Vector Backbone:pFasBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:20 | 0 | ||
|
pCMV HA hRB delta CDK + S612 Resource Report Resource Website 1+ mentions |
RRID:Addgene_58914 | Rb | Homo sapiens | Ampicillin | PMID:24876129 | *CDK mutations (all changed to Ala): T5, S239, S249, T252, T356, T373, S608, S612, S780, S788, S795, S807, S811, T821, T826 | Backbone Marker:Clontech; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | delta CDK* with S612 restored | 2026-08-15 01:17:19 | 1 |
|
pCMV HA hRB delta CDK + S807 Resource Report Resource Website 1+ mentions |
RRID:Addgene_58918 | Rb | Homo sapiens | Ampicillin | PMID:24876129 | *CDK mutations (all changed to Ala): T5, S239, S249, T252, T356, T373, S608, S612, S780, S788, S795, S807, S811, T821, T826 | Backbone Marker:Clontech; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | delta CDK* with S807 restored | 2026-08-15 01:17:19 | 1 |
|
pCMV HA hRB delta CDK + T821 Resource Report Resource Website |
RRID:Addgene_58920 | Rb | Homo sapiens | Ampicillin | PMID:24876129 | *CDK mutations (all changed to Ala): T5, S239, S249, T252, T356, T373, S608, S612, S780, S788, S795, S807, S811, T821, T826 | Backbone Marker:Clontech; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | delta CDK* with T821 restored | 2026-08-15 01:17:19 | 0 |
|
pET-28a-GFP-Patronin CC 868–1457 Resource Report Resource Website 1+ mentions |
RRID:Addgene_59053 | Patronin | Drosophila melanogaster | Kanamycin | PMID:24706919 | Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:20 | 1 | ||
|
pCAG-FLEX-rc[Chronos-GFP] Resource Report Resource Website 1+ mentions |
RRID:Addgene_59056 | Chronos-GFP | Stigeoclonium helveticum | Ampicillin | PMID:24509633 | The depositing lab sequenced this plasmid completely except for the CAG promoter. | Backbone Marker:Addgene (Plasmid 11159); Backbone Size:5117; Vector Backbone:pCAGIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:20 | 3 | |
|
pET-21a-GFP-Patronin CC 1288–1457 Resource Report Resource Website |
RRID:Addgene_59055 | Patronin | Drosophila melanogaster | Ampicillin | PMID:24706919 | Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:20 | 0 | ||
|
pcdna3 Flag Jip3b(T266A, T276A, T287A) Resource Report Resource Website |
RRID:Addgene_58924 | mitogen-activated protein kinase 8 interacting protein 3 | Mus musculus | Ampicillin | PMID:10629060 | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcdna3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | changed T266A, T276A, T287A | 2026-08-15 01:17:19 | 0 | |
|
pCDNA3 T7 Jip4 (1-272) Resource Report Resource Website |
RRID:Addgene_58928 | Mapk8ip4 | Mus musculus | Ampicillin | PMID:15767678 | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcdna3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Jip4 (1-272aa) | 2026-08-15 01:17:19 | 0 | |
|
Tg (mpx:mCherry-2A-Rac2D57N) Resource Report Resource Website |
RRID:Addgene_58934 | mcherry-2a-Rac2D57N | Danio rerio | Ampicillin | PMID:22014524 | Backbone Size:3500; Vector Backbone:Tol2; Vector Types:; Bacterial Resistance:Ampicillin | changed Aspartate 57 to Asparagine | 2026-08-15 01:17:19 | 0 | |
|
pAAV-Syn-CoChR-GFP Resource Report Resource Website 10+ mentions |
RRID:Addgene_59070 | CoChR-GFP | Chloromonas oogama | Ampicillin | PMID:24509633 | Plasmid is completely sequenced by the depositing lab except for part of the 3' ITR. Addgene QC NGS analysis identifies ambiguous bases following the 3' ITR. It is unknown what, if any, impact this may have on plasmid function. | Backbone Size:4368; Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:20 | 11 | |
|
tol2-mpeg1-mcherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_58935 | mpeg1-mcherry | Ampicillin | Backbone Size:3500; Vector Backbone:Tol2; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:20 | 2 | ||||
|
pCDNA-FRT-FAK10 Resource Report Resource Website |
RRID:Addgene_59119 | Focal Adhesion Kinase | Gallus gallus | Ampicillin | PMID:23393139 | Discrepancies between QC and full sequence are of no functional consequence | Backbone Marker:Invitrogen; Backbone Size:5002; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:20 | 0 | |
|
SI16-Kit a Resource Report Resource Website |
RRID:Addgene_58948 | Kit receptor a mouse monoclonal antibody | Danio rerio | Ampicillin | PMID:20525357 | Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:20 | 0 | ||
|
pCDNA-FRT-FAK-FERM10 Resource Report Resource Website |
RRID:Addgene_59126 | Focal Adhesion Kinase | Gallus gallus | Ampicillin | PMID:23393139 | Discrepancies between QC and full sequence are of no functional consequence | Backbone Marker:Invitrogen; Backbone Size:5002; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:21 | 0 | |
|
pCDNA-FRT-FAK-FERM0 Resource Report Resource Website |
RRID:Addgene_59125 | Focal Adhesion Kinase | Gallus gallus | Ampicillin | PMID:23393139 | Discrepancies between QC and full sequence are of no functional consequence | Backbone Marker:Invitrogen; Backbone Size:5002; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:20 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.