Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pU6-sgGAL4-4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46916 sgGAL4-4 Ampicillin PMID:23849981 gRNA target sequence GAACGACTAGTTAGGCGTGTA Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 1
Beclin-HA S-A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46994 becn1 Mus musculus Ampicillin PMID:23685627 Vector Backbone:pqcxih; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S14A 2026-08-15 01:15:37 1
Beclin-HA S-D
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46995 becn1 Mus musculus Ampicillin PMID:23685627 Vector Backbone:pqcxih; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S14D 2026-08-15 01:15:37 1
pRK5-EGFP-Tau E14 P301L
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46909 Tau E14 P301L Homo sapiens Ampicillin PMID:21172610 WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14. Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin P301L AND all 14 S/P or T/P amino acid residues (T111, T153, T175, T181, S199, S202, T205, T212, T217, T231, S235, S396, S404, and S422; numbering based on the longest 441-amino acid brain isoform of htau) changed to glutamate 2026-08-15 01:15:36 2
pRK5-EGFP-Tau E14
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46907 Tau E14 Homo sapiens Ampicillin PMID:21172610 WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14. Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin all 14 S/P or T/P amino acid residues (T111, T153, T175, T181, S199, S202, T205, T212, T217, T231, S235, S396, S404, and S422; numbering based on the longest 441-amino acid brain isoform of htau) to glutamate 2026-08-15 01:15:37 7
pRK5-EGFP-Tau AP P301L
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46906 Tau AP P301L Homo sapiens Ampicillin PMID:21172610 WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14. Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin P301L AND all 14 S/P or T/P amino acid residues (T111, T153, T175, T181, S199, S202, T205, T212, T217, T231, S235, S396, S404, and S422; numbering based on the longest 441-amino acid brain isoform of htau) changed to alanine 2026-08-15 01:15:36 1
pGEX6P1-3xMBT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46987 Triple MBT domain from human L3MBTL1 Homo sapiens Ampicillin PMID:23583077 Original description of the plasmid in West et al. J Biol Chem. 2010 Nov 26;285(48):37725-32. Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 190–530 of accession NP_056293.4 2026-08-15 01:15:37 1
pET12a-AL-09 FL
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47081 AL-09 Homo sapiens Ampicillin PMID:16751605 Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:38 1
pT3TS-Cre
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47117 Cre Ampicillin PMID:21552255 Backbone Marker:Addgene plasmid 31830; Backbone Size:3216; Vector Backbone:pT3TS; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:15:38 1
pBXNH3A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47075 Chloramphenicol and Ampicillin PMID:21410291 Backbone Marker:Eric R Geertsma & Bert Poolman; Backbone Size:5824; Vector Backbone:pBADnLIC; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:15:38 2
pBXNAC3GH
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47073 Chloramphenicol and Ampicillin PMID:21410291 Backbone Marker:LM Guzman; Backbone Size:5779; Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:15:37 1
pREXNH3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47079 Chloramphenicol and Ampicillin PMID:21410291 Backbone Marker:Eric R Geertsma & Bert Poolman; Backbone Size:5519; Vector Backbone:pRExLIC; Vector Types:Lactococcus lactis expression; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:15:37 1
pBMN ltDHFR(DD)-YFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47076 ltDHFR(DD) E. coli Ampicillin PMID:23991108 This N-terminal ltDHFR(DD) plasmid is the clone#22 in Table 1 Backbone Marker:Garry Nolan ; Backbone Size:6943; Vector Backbone:pBMN; Vector Types:Retroviral; Bacterial Resistance:Ampicillin amino acids mutations: R12H, N23S, G67S, V78A, E120G, E134G, E153V, E157G 2026-08-15 01:15:37 3
pBXC3GH
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47070 Chloramphenicol and Ampicillin PMID:21410291 Folding indicator GFP Backbone Marker:LM Guzman; Backbone Size:6556; Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:15:37 5
pBXCA3GH
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47071 Chloramphenicol and Ampicillin PMID:21410291 Backbone Marker:LM Guzman; Backbone Size:5779; Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:15:37 3
pcDNA-dCas9-VP64
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_47107 dCas9-VP64 S. Pyogenes Ampicillin PMID:23892895 Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin D10A, H840A (catalytically inactive) 2026-08-15 01:15:38 23
pBXC3H
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47068 Chloramphenicol and Ampicillin PMID:21410291 Backbone Marker:LM Guzman; Backbone Size:5780; Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:15:37 5
pENTR-FOXP2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47053 Forkhead Box P2 Homo sapiens Spectinomycin PMID:21653829 Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:37 1
pJBEI-6410
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47049 Codon-optimized sequences for MEV pathway expression in E. coli to produce limonene Saccharomyces cerevisiae Ampicillin PMID:23727191 The R364S mutation in the MK is not known to alter the function. The plasmid functions as described in the associated publication. Backbone Size:3500; Vector Backbone:pBbA5a; Vector Types:Bacterial Expression, Synthetic Biology, BglBrick; Bacterial Resistance:Ampicillin R364S mutation in MK 2026-08-15 01:15:37 2
R26P-M2rtTA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47381 M2rtTA Ampicillin PMID:16400644 Backbone Size:9846; Vector Backbone:ROSA26-1; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin 2026-08-15 01:15:41 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch