Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: sgGAL4-4
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: gRNA target sequence GAACGACTAGTTAGGCGTGTA
Proper citation: RRID:Addgene_46916 Copy
Species: Mus musculus
Genetic Insert: becn1
Vector Backbone Description: Vector Backbone:pqcxih; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23685627
Proper citation: RRID:Addgene_46994 Copy
Species: Mus musculus
Genetic Insert: becn1
Vector Backbone Description: Vector Backbone:pqcxih; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23685627
Proper citation: RRID:Addgene_46995 Copy
Species: Homo sapiens
Genetic Insert: Tau E14 P301L
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21172610
Comments: WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14.
Proper citation: RRID:Addgene_46909 Copy
Species: Homo sapiens
Genetic Insert: Tau E14
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21172610
Comments: WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14.
Proper citation: RRID:Addgene_46907 Copy
Species: Homo sapiens
Genetic Insert: Tau AP P301L
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21172610
Comments: WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14.
Proper citation: RRID:Addgene_46906 Copy
Species: Homo sapiens
Genetic Insert: Triple MBT domain from human L3MBTL1
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23583077
Comments: Original description of the plasmid in West et al. J Biol Chem. 2010 Nov 26;285(48):37725-32.
Proper citation: RRID:Addgene_46987 Copy
Species: Homo sapiens
Genetic Insert: AL-09
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16751605
Proper citation: RRID:Addgene_47081 Copy
Genetic Insert: Cre
Vector Backbone Description: Backbone Marker:Addgene plasmid 31830; Backbone Size:3216; Vector Backbone:pT3TS; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21552255
Proper citation: RRID:Addgene_47117 Copy
Vector Backbone Description: Backbone Marker:Eric R Geertsma & Bert Poolman; Backbone Size:5824; Vector Backbone:pBADnLIC; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21410291
Proper citation: RRID:Addgene_47075 Copy
Vector Backbone Description: Backbone Marker:LM Guzman; Backbone Size:5779; Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21410291
Proper citation: RRID:Addgene_47073 Copy
Vector Backbone Description: Backbone Marker:Eric R Geertsma & Bert Poolman; Backbone Size:5519; Vector Backbone:pRExLIC; Vector Types:Lactococcus lactis expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21410291
Proper citation: RRID:Addgene_47079 Copy
Species: E. coli
Genetic Insert: ltDHFR(DD)
Vector Backbone Description: Backbone Marker:Garry Nolan ; Backbone Size:6943; Vector Backbone:pBMN; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23991108
Comments: This N-terminal ltDHFR(DD) plasmid is the clone#22 in Table 1
Proper citation: RRID:Addgene_47076 Copy
Vector Backbone Description: Backbone Marker:LM Guzman; Backbone Size:6556; Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21410291
Comments: Folding indicator GFP
Proper citation: RRID:Addgene_47070 Copy
Vector Backbone Description: Backbone Marker:LM Guzman; Backbone Size:5779; Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21410291
Proper citation: RRID:Addgene_47071 Copy
Species: S. Pyogenes
Genetic Insert: dCas9-VP64
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23892895
Proper citation: RRID:Addgene_47107 Copy
Vector Backbone Description: Backbone Marker:LM Guzman; Backbone Size:5780; Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21410291
Proper citation: RRID:Addgene_47068 Copy
Species: Homo sapiens
Genetic Insert: Forkhead Box P2
Vector Backbone Description: Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21653829
Proper citation: RRID:Addgene_47053 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Codon-optimized sequences for MEV pathway expression in E. coli to produce limonene
Vector Backbone Description: Backbone Size:3500; Vector Backbone:pBbA5a; Vector Types:Bacterial Expression, Synthetic Biology, BglBrick; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23727191
Comments: The R364S mutation in the MK is not known to alter the function. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_47049 Copy
Genetic Insert: M2rtTA
Vector Backbone Description: Backbone Size:9846; Vector Backbone:ROSA26-1; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16400644
Proper citation: RRID:Addgene_47381 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
