Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: CBP CH2 (1192-1318)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23831576
Proper citation: RRID:Addgene_99338 Copy
Species: Mus musculus
Genetic Insert: mouse CBP HAT domain (1324-1700)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5493; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28630323
Proper citation: RRID:Addgene_99340 Copy
Species: Mus musculus
Genetic Insert: Dlx6
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_99480 Copy
Species: Mus musculus
Genetic Insert: Beclin 1
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:pCDH-CMV-MCS-EF1-copGFP-T2A-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28806762
Proper citation: RRID:Addgene_99506 Copy
Species: Mus musculus
Genetic Insert: Beclin 1
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:pCDH-CMV-MCS-EF1-copGFP-T2A-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28806762
Proper citation: RRID:Addgene_99505 Copy
Species: Mus musculus
Genetic Insert: Gt(Rosa)26Sor
Vector Backbone Description: Vector Backbone:pBlueScript KS II; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28802047
Proper citation: RRID:Addgene_99632 Copy
Species: Mus musculus
Genetic Insert: dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG )
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99690 Copy
Species: Mus musculus
Genetic Insert: dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG)
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99691 Copy
Species: Mus musculus
Genetic Insert: dCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG)
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99694 Copy
Species: Mus musculus
Genetic Insert: dCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC)
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99693 Copy
Species: Mus musculus
Genetic Insert: Tmeff2
Vector Backbone Description: Vector Backbone:pT7T3D-PacI; Vector Types:in situ probe; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28336932
Comments: Plasmid contains bp 474-1125 of Tmeff2 for synthesis of in situ RNA probe.
Proper citation: RRID:Addgene_99728 Copy
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-lCLtLOX2nux7hIbGPPvS
Proper citation: RRID:Addgene_99849 Copy
Species: Mus musculus
Genetic Insert: Pdgfra
Vector Backbone Description: Vector Backbone:pCDH-CMV-MCS-EF1-nlsCopGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28336932
Proper citation: RRID:Addgene_99731 Copy
Species: Mus musculus
Genetic Insert: Tmeff2
Vector Backbone Description: Vector Backbone:pCDH-CMV-MCS-EF1-copGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28336932
Proper citation: RRID:Addgene_99730 Copy
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-Vmmiso11jfO8MtXzoU8z
Proper citation: RRID:Addgene_99851 Copy
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-dlShiFGpeuVBSA5HJWf5
Proper citation: RRID:Addgene_99856 Copy
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-svYERWnWOgr5oWH0zkCI
Proper citation: RRID:Addgene_99855 Copy
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-jaXnPD3n17hIVooU9T53
Proper citation: RRID:Addgene_99858 Copy
Species: Mus musculus
Genetic Insert: SaCas9 gRNA targeting Yap1
Vector Backbone Description: Backbone Marker:Feng Zhang Lab (Addgene #61591); Vector Backbone:pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27926730
Proper citation: RRID:Addgene_99736 Copy
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-KstXbFqA9I33Cfej0MXL
Proper citation: RRID:Addgene_99860 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.