Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 190 showing 3781 ~ 3800 out of 12,959 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_99338

http://www.addgene.org/99338

Species: Mus musculus
Genetic Insert: CBP CH2 (1192-1318)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23831576

Proper citation: RRID:Addgene_99338 Copy   

    • RRID:Addgene_99340

    This resource has 1+ mentions.

http://www.addgene.org/99340

Species: Mus musculus
Genetic Insert: mouse CBP HAT domain (1324-1700)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5493; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28630323

Proper citation: RRID:Addgene_99340 Copy   

    • RRID:Addgene_99480

    This resource has 1+ mentions.

http://www.addgene.org/99480

Species: Mus musculus
Genetic Insert: Dlx6
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_99480 Copy   

    • RRID:Addgene_99506

    This resource has 1+ mentions.

http://www.addgene.org/99506

Species: Mus musculus
Genetic Insert: Beclin 1
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:pCDH-CMV-MCS-EF1-copGFP-T2A-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28806762

Proper citation: RRID:Addgene_99506 Copy   

    • RRID:Addgene_99505

http://www.addgene.org/99505

Species: Mus musculus
Genetic Insert: Beclin 1
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:pCDH-CMV-MCS-EF1-copGFP-T2A-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28806762

Proper citation: RRID:Addgene_99505 Copy   

    • RRID:Addgene_99632

    This resource has 1+ mentions.

http://www.addgene.org/99632

Species: Mus musculus
Genetic Insert: Gt(Rosa)26Sor
Vector Backbone Description: Vector Backbone:pBlueScript KS II; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28802047

Proper citation: RRID:Addgene_99632 Copy   

http://www.addgene.org/99690

Species: Mus musculus
Genetic Insert: dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG )
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

Proper citation: RRID:Addgene_99690 Copy   

http://www.addgene.org/99691

Species: Mus musculus
Genetic Insert: dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG)
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

Proper citation: RRID:Addgene_99691 Copy   

http://www.addgene.org/99694

Species: Mus musculus
Genetic Insert: dCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG)
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

Proper citation: RRID:Addgene_99694 Copy   

http://www.addgene.org/99693

Species: Mus musculus
Genetic Insert: dCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC)
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

Proper citation: RRID:Addgene_99693 Copy   

    • RRID:Addgene_99728

http://www.addgene.org/99728

Species: Mus musculus
Genetic Insert: Tmeff2
Vector Backbone Description: Vector Backbone:pT7T3D-PacI; Vector Types:in situ probe; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28336932
Comments: Plasmid contains bp 474-1125 of Tmeff2 for synthesis of in situ RNA probe.

Proper citation: RRID:Addgene_99728 Copy   

http://www.addgene.org/99849

Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-lCLtLOX2nux7hIbGPPvS

Proper citation: RRID:Addgene_99849 Copy   

http://www.addgene.org/99731

Species: Mus musculus
Genetic Insert: Pdgfra
Vector Backbone Description: Vector Backbone:pCDH-CMV-MCS-EF1-nlsCopGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28336932

Proper citation: RRID:Addgene_99731 Copy   

http://www.addgene.org/99730

Species: Mus musculus
Genetic Insert: Tmeff2
Vector Backbone Description: Vector Backbone:pCDH-CMV-MCS-EF1-copGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28336932

Proper citation: RRID:Addgene_99730 Copy   

http://www.addgene.org/99851

Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-Vmmiso11jfO8MtXzoU8z

Proper citation: RRID:Addgene_99851 Copy   

http://www.addgene.org/99856

Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-dlShiFGpeuVBSA5HJWf5

Proper citation: RRID:Addgene_99856 Copy   

http://www.addgene.org/99855

Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-svYERWnWOgr5oWH0zkCI

Proper citation: RRID:Addgene_99855 Copy   

http://www.addgene.org/99858

Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-jaXnPD3n17hIVooU9T53

Proper citation: RRID:Addgene_99858 Copy   

http://www.addgene.org/99736

Species: Mus musculus
Genetic Insert: SaCas9 gRNA targeting Yap1
Vector Backbone Description: Backbone Marker:Feng Zhang Lab (Addgene #61591); Vector Backbone:pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27926730

Proper citation: RRID:Addgene_99736 Copy   

http://www.addgene.org/99860

Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-KstXbFqA9I33Cfej0MXL

Proper citation: RRID:Addgene_99860 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch