Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: miniTurbo (BirA mutant)
Vector Backbone Description: Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30125270
Comments: Please visit https://www.biorxiv.org/content/early/2017/10/02/196980 for BioRxiv preprint
Proper citation: RRID:Addgene_107174 Copy
Species: Homo sapiens
Genetic Insert: S100A11
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_107201 Copy
Species: Homo sapiens
Genetic Insert: p300 delta33
Vector Backbone Description: Backbone Marker:not the same as the commercial CMVb; Backbone Size:4800; Vector Backbone:CMVbeta; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: see author's map for pCMVb p300 wt for map of empty pCMVb vector.
Proper citation: RRID:Addgene_10719 Copy
Species: Homo sapiens
Genetic Insert: MARS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: See author's map for cloning details. 2 BamHI sites in insert as well.
Proper citation: RRID:Addgene_10716 Copy
Species: Homo sapiens
Genetic Insert: HA-tagged Kras4B(G12V) and GFP
Vector Backbone Description: Backbone Size:11261; Vector Backbone:pLVET-IRES-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28604746
Comments: K-RasG12V PCR:ed from pLenti-PGK-KRAS4B(G12V)(Addgene #35633) and ligated as PmeI/BamHI fragment into pLVET-IRES-GFP
Proper citation: RRID:Addgene_107140 Copy
Vector Backbone Description: Backbone Marker:Derived from pLVET-tTR-KRAB by P. Aebisher/D. Trono (Addgene plasmid #11644); Backbone Size:11261; Vector Backbone:pLVET; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28604746
Comments: pLVET-GFP-tTR-KRAB vector (Addgene#11644) was modified by first removing tTR-KRAB with EcoRI then ligating IRES-GFP from pMSCV PIG (Addgene #21654) as a blunt end PCR fragment into previously generated pLVET-GFP cut with SmaI. Finally original GFP was removed with EcoRI/MluI => ends blunted and vector religated to generate pLVET-IRES-GFP.
Proper citation: RRID:Addgene_107139 Copy
Species: Mus musculus
Genetic Insert: Ezh2
Vector Backbone Description: Backbone Size:6573; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_107146 Copy
Species: Synthetic
Genetic Insert: GFP + sgRNA for GFP
Vector Backbone Description: Vector Backbone:pXPR_047; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA sequence is GGTGAACCGCATCGAGCTGA
pLKO TRC v2 library vector, Puro selection and eGFP expression.
Proper citation: RRID:Addgene_107145 Copy
Species: Homo sapiens
Genetic Insert: SMAD4
Vector Backbone Description: Vector Backbone:pLVX-IRES-Hyg; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26898331
Proper citation: RRID:Addgene_107128 Copy
Species: Homo sapiens
Genetic Insert: RB del22
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9420334
Comments: EcoRI is an internal site as well. See author's map. To learn more about del22 mutant, see reference: Sellers WR, Rodgers JW, and Kaelin WG, PNAS 92:11544.
Proper citation: RRID:Addgene_10721 Copy
Species: Homo sapiens
Genetic Insert: RB
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9420334
Proper citation: RRID:Addgene_10720 Copy
Species: Synthetic
Genetic Insert: ecAT3.10
Vector Backbone Description: Backbone Marker:modified from Invitrogen; Backbone Size:5000; Vector Backbone:pCMV(MinDis) [variant of pDisplay]; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29121644
Proper citation: RRID:Addgene_107215 Copy
Species: Other
Genetic Insert: EF2132
Vector Backbone Description: Backbone Size:5750; Vector Backbone:pCN-50; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29463653
Proper citation: RRID:Addgene_107191 Copy
Species: Synthetic
Genetic Insert: 1D3-28Z. 1-3 mut
Vector Backbone Description: Backbone Size:5586; Vector Backbone:MSGV1; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20631379
Proper citation: RRID:Addgene_107227 Copy
Species: Synthetic
Genetic Insert: 1D3-28Z All ITAMs intact
Vector Backbone Description: Backbone Size:5584; Vector Backbone:MSGV1; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20631379
Proper citation: RRID:Addgene_107226 Copy
Genetic Insert: KKH SaCas9
Vector Backbone Description: Backbone Marker:Richard Sherwood Lab; Backbone Size:6637; Vector Backbone:p2T-CAG-MCS-BlastR; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30405244
Proper citation: RRID:Addgene_107189 Copy
Species: Other
Genetic Insert: aCamkII-mCherry-P2A-Cre-WPRE-BGH-polyA
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29335603
Proper citation: RRID:Addgene_107313 Copy
Species: Other
Genetic Insert: EF1α-scFv-p65-HSF1-T2A-EGFP-WPRE-PolyA
Vector Backbone Description: Vector Backbone:Lentivirus; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29335603
Proper citation: RRID:Addgene_107311 Copy
Species: Other
Genetic Insert: dSV40-dCas9-10xGCN4
Vector Backbone Description: Vector Backbone:Lentivirus; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29335603
Proper citation: RRID:Addgene_107310 Copy
Species: S. aureus
Genetic Insert: SaCas9
Vector Backbone Description: Vector Backbone:pCSDest2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30451839
Proper citation: RRID:Addgene_107317 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.