Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 191 showing 3801 ~ 3820 out of 328,630 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_47932

http://www.addgene.org/47932

Species: Danio rerio
Genetic Insert: ddx19 gRNA
Vector Backbone Description: Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918387
Comments: For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ gRNA target sequence GGCAACAGATTCGTGGGCCC

Proper citation: RRID:Addgene_47932 Copy   


  • RRID:Addgene_47891

    This resource has 1+ mentions.

http://www.addgene.org/47891

Species: Homo sapiens
Genetic Insert: Miro2
Vector Backbone Description: Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12482879

Proper citation: RRID:Addgene_47891 Copy   


  • RRID:Addgene_47926

http://www.addgene.org/47926

Species: Mus musculus
Genetic Insert: E-Cadherin EC12
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5406; Vector Backbone:pET-22b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23923816
Comments: Plasmid contains E-Cadherin domains 1 and 2 (aa157-375, when compared to GenBank reference sequence NP_033994.1). Numbering of the mutations is relative to this sequence. The pro-peptide sequence that is normally cleaved during maturation was intentionally removed as part of the cloning strategy for expression in bacteria.

Proper citation: RRID:Addgene_47926 Copy   


  • RRID:Addgene_47924

http://www.addgene.org/47924

Species: Mus musculus
Genetic Insert: E-Cadherin EC12
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5406; Vector Backbone:pET-22b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23923816
Comments: Plasmid contains E-Cadherin domains 1 and 2 (aa157-375, when compared to GenBank reference sequence NP_033994.1). Numbering of the mutation is relative to this sequence. The pro-peptide sequence that is normally cleaved during maturation was intentionally removed as part of the cloning strategy for expression in bacteria.

Proper citation: RRID:Addgene_47924 Copy   


  • RRID:Addgene_47928

    This resource has 1+ mentions.

http://www.addgene.org/47928

Species: Synthetic
Genetic Insert: T1ER
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23838183
Comments: Ratiometric calcium sensor targeted to ER with KDEL sequence. The CFP fragment of Addgene plasmid 36325 pcDNA-D1ER was replaced with the brighter fluorescent protein mTurquoise.

Proper citation: RRID:Addgene_47928 Copy   


  • RRID:Addgene_47929

    This resource has 100+ mentions.

http://www.addgene.org/47929

Species: Synthetic
Genetic Insert: nls-zcas9-nls
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918387
Comments: Note from depositor: Although this plasmid produces smaller transcripts in addition to the expected one, the product mixture displays activity comparable to that from pT3TS-nCas9n. For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/

Proper citation: RRID:Addgene_47929 Copy   


  • RRID:Addgene_47883

http://www.addgene.org/47883

Genetic Insert: TALE-mClover
Vector Backbone Description: Vector Backbone:pTALYM3; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24096363

Proper citation: RRID:Addgene_47883 Copy   


  • RRID:Addgene_47884

    This resource has 1+ mentions.

http://www.addgene.org/47884

Genetic Insert: H2B-tdiRFP
Vector Backbone Description: Vector Backbone:pCAG-ME-IP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24096363

Proper citation: RRID:Addgene_47884 Copy   


  • RRID:Addgene_47888

    This resource has 10+ mentions.

http://www.addgene.org/47888

Species: Homo sapiens
Genetic Insert: Miro1
Vector Backbone Description: Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12482879

Proper citation: RRID:Addgene_47888 Copy   


  • RRID:Addgene_47875

    This resource has 1+ mentions.

http://www.addgene.org/47875

Vector Backbone Description: Vector Backbone:pCAG-T7-TALEN (Sangamo); Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24096363

Proper citation: RRID:Addgene_47875 Copy   


  • RRID:Addgene_47872

    This resource has 1+ mentions.

http://www.addgene.org/47872

Species: N meningitidis
Genetic Insert: NmCas9
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pSimpleII; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23940360

Proper citation: RRID:Addgene_47872 Copy   


  • RRID:Addgene_47878

    This resource has 10+ mentions.

http://www.addgene.org/47878

Genetic Insert: TALE-mClover
Vector Backbone Description: Vector Backbone:pTALYM3; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24096363

Proper citation: RRID:Addgene_47878 Copy   


  • RRID:Addgene_47911

    This resource has 1+ mentions.

http://www.addgene.org/47911

Species: Homo sapiens
Genetic Insert: hCas9 with C. elegans 5' and 3' UTRs
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:Bluescript; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979577

Proper citation: RRID:Addgene_47911 Copy   


  • RRID:Addgene_47879

    This resource has 1+ mentions.

http://www.addgene.org/47879

Genetic Insert: TALE-mRuby2
Vector Backbone Description: Vector Backbone:pTALYM4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24096363

Proper citation: RRID:Addgene_47879 Copy   


  • RRID:Addgene_47876

    This resource has 1+ mentions.

http://www.addgene.org/47876

Vector Backbone Description: Vector Backbone:pCAG-T7-TALEN (Sangamo); Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24096363

Proper citation: RRID:Addgene_47876 Copy   


  • RRID:Addgene_47877

http://www.addgene.org/47877

Genetic Insert: TALE-Ty1
Vector Backbone Description: Vector Backbone:pTALYM9; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24096363

Proper citation: RRID:Addgene_47877 Copy   


http://www.addgene.org/47869

Species: N meningitidis
Genetic Insert: NmCas9
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pSimpleII; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23940360

Proper citation: RRID:Addgene_47869 Copy   


  • RRID:Addgene_47902

    This resource has 1+ mentions.

http://www.addgene.org/47902

Species: Homo sapiens
Genetic Insert: human LIN28A
Vector Backbone Description: Backbone Marker:Dr.Toshio Kitamura of the University of Tokyo; Backbone Size:4800; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23812749
Comments: pMXs is from Dr. Toshio Kitamura of the University of Tokyo, the Institute of Medical Science. If you use this plasmid in a paper, please cite: Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Exp Hematol. 2003 Nov;31(11):1007-14. Kitamura T, Koshino Y, Shibata F, Oki T, Nakajima H, Nosaka T, Kumagai H.

Proper citation: RRID:Addgene_47902 Copy   


  • RRID:Addgene_47903

    This resource has 1+ mentions.

http://www.addgene.org/47903

Species: Rhodopseudomonas palustris
Genetic Insert: Infrared fluorescent protein
Vector Backbone Description: Backbone Marker:Karl Deisseroth; Vector Backbone:pAAV CaMKII hChR2-EYFP; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28380331

Proper citation: RRID:Addgene_47903 Copy   


  • RRID:Addgene_47906

    This resource has 1+ mentions.

http://www.addgene.org/47906

Species: Rhodopseudomonas palustris
Genetic Insert: Infrared fluorescent protein
Vector Backbone Description: Backbone Marker:NIDA OTTC; Vector Backbone:pAAV c-fos eYFP; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28380331
Comments: Note that the "N" in the depositor's sequences is legitimately ambiguous in both the Addgene stock and the depositor's original stock. This repeat region may vary in different preps of the plasmid, but it should not affect the plasmid function.

Proper citation: RRID:Addgene_47906 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X