Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Mentions:yes (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
RINS1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_107290 RINS1 Homo sapiens Kanamycin PMID:28366620 Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:01:08 2
pCSD_2xNLS-SpCas9WT-NLS-3xHA-NLS-SaCas9WT-2xNLS
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_107320 SpCas9-SaCas9 fusion Synthetic Ampicillin PMID:30451839 Vector Backbone:pCSDest2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin SpCas9 is fused to SaCas9 2026-08-15 01:01:08 1
RNA motif plasmid cloning backbone
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_107253 RNA motif plasmid cloning backbone Ampicillin PMID:29400715 Digest plasmid with BsmBI and ligate RNA motif of interest. The RNA motif of interest would be in the 3UTR and flanked by BoxB motifs. Oligo cloning can be performed similarly to sgRNA cloning. Primers to order: Primers (5'->3') F GCTT R AGCT Example to clone in motif IRE motif IRE motif: TAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAA Primers to order F: GCTT TAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAA R: AGCT TTATACATTATGGAAGACACTGCTCCCGATAATGTGTTA Vector Backbone:pLEX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 5
6x Halo-EGFP- 2x PACT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_107265 6x Halo-EGFP- 2x PACT Homo sapiens Ampicillin PMID:29097549 Vector Backbone:pERB219; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 1
pSB3C5-proD-B0032-E0051
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_107241 ProA-RBS(B0032)-Gemini (E0051) Synthetic Chloramphenicol PMID:20843779 Backbone Marker:http://parts.igem.org/Part:pSB3C5; Backbone Size:2738; Vector Backbone:pSB3C5; Vector Types:; Bacterial Resistance:Chloramphenicol 2026-08-15 01:01:08 1
pLX304-MARK3
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_107235 MARK3 Ampicillin PMID:29431698 Please visit https://www.biorxiv.org/content/early/2017/02/09/107201 for bioRxiv preprint. Backbone Marker:Addgene; Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 1
pNP1 sfGFP toehold switch
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_107355 toehold 7 + sfGFP Ampicillin PMID:30083608 Backbone Marker:New England Biolabs (cloning vector); Backbone Size:2202; Vector Backbone:pNP1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:09 1
BASU RaPID plasmid
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_107250 BASU Synthetic Ampicillin PMID:29400715 The BASU protein sequence has 4 mutations relative to wild type Bacillus subtilis biotin ligase (Uniprot P0CI75): N terminal truncation of 65 aa, R124G, E323S and G325R. Vector Backbone:pLEX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 10
pDisplay-Rncp-iGluSnFR1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_107336 Rncp-iGluSnFR1 Synthetic Ampicillin PMID:29308878 Please note that mutation M178K in the Neomycin resistance cassette was found during Addgene's quality control. Neomycin selection has not been tested for this plasmid, but should not affect sensor function. Backbone Marker:Invitrogen; Backbone Size:5268; Vector Backbone:pDisplay; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:10 2
498 pSG5L HA RB del663 (NAAIRS)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_10728 RB del663 Homo sapiens Ampicillin PMID:9420334 del663 created by site-directed mutagenesis using this primer: GCCTATCTCCGGCTAaatgctgctatacgatcgCTTCTGTCTGAGCAC Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin residues 664 to 669 were replaced by NAAIRS, a flexible polylinker 2026-08-15 01:01:09 1
432 pSG5L HA RB 567L
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_10725 RB 567L Homo sapiens Ampicillin PMID:9420334 567L created by site-directed mutagenesis using this primer: GCATGGCTCTCAGATcttCCTTTATTTGATCTT Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 567L 2026-08-15 01:01:08 1
pLVX-HA-UBE3A-IRES-Puro
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_107349 UBE3A Homo sapiens Ampicillin PMID:28003368 Backbone Size:8247; Vector Backbone:pLVX-GWB-IRES-Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:01:09 1
PD-L1-miSFIT-Ce67
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_124686 PD-L1 Homo sapiens Ampicillin PMID:30778069 Bi-directional expression vector driving PD-L1 under control of a miR-17 MRE with NGFR as an internal control Backbone Marker:Addgene: 85866; Vector Backbone:AB.pCCL.sin.cPPT.GFP.miR-17-3p.sensor.PGK.dNGFR.WPRE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:04:08 1
pMaCTag-Z07
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_124790 mNeonGreen Homo sapiens Ampicillin PMID:32406907 Template plasmid for C-terminal PCR tagging of mammalian genes. For M1 and M2 tagging oligo design please visit www.pcr-tagging.com Please visit https://www.biorxiv.org/content/early/2018/11/20/473876 for BioRxiv preprint Backbone Size:2412; Vector Backbone:pFA6a; Vector Types:PCR Template; Bacterial Resistance:Ampicillin 2026-08-15 01:04:09 2
PD-1-miSFIT-4x
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_124678 PD-1 Homo sapiens Ampicillin PMID:30778069 Bi-directional expression vector driving PD-1 under control of a miR-17 MRE with NGFR as an internal control Backbone Marker:Addgene: 85866; Vector Backbone:AB.pCCL.sin.cPPT.GFP.miR-17-3p.sensor.PGK.dNGFR.WPRE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:04:08 1
PD-1-miSFIT-1x
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_124679 PD-1 Homo sapiens Ampicillin PMID:30778069 Bi-directional expression vector driving PD-1 under control of a miR-17 MRE with NGFR as an internal control Backbone Marker:Addgene: 85866; Vector Backbone:AB.pCCL.sin.cPPT.GFP.miR-17-3p.sensor.PGK.dNGFR.WPRE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:04:08 1
MS2_adRNA-MCP_ADAR2 DD (E488Q)_NLS
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_124705 MCP_ADAR2 DD (E488Q)_NLS Homo sapiens Kanamycin PMID:30737497 Also expresses MS2_adRNA targeting the RAB7A transcript Backbone Size:4700; Vector Backbone:Unknown; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Kanamycin E488Q hyperactive mutant 2026-08-15 01:04:09 1
pMaCTag-P07
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_124788 mNeonGreen Homo sapiens Ampicillin PMID:32406907 Template plasmid for C-terminal PCR tagging of mammalian genes. For M1 and M2 tagging oligo design please visit www.pcr-tagging.com Please visit https://www.biorxiv.org/content/early/2018/11/20/473876 for BioRxiv preprint Backbone Size:2412; Vector Backbone:pFA6a; Vector Types:PCR Template; Bacterial Resistance:Ampicillin 2026-08-15 01:04:09 1
pLenti-PGK-Venus-Akaluc (neo)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_124701 Venus-Akaluciferase Synthetic Ampicillin PMID:33241215 Backbone Marker:Eric Campeau & Paul Kaufman; Backbone Size:9780; Vector Backbone:pLenti PGK Neo DEST (Addgene #19067); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:04:09 2
Lenti-Cas9-gRNA-GFP
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_124770 Ampicillin PMID:31503414 Vector Backbone:LRG2.1 (Addgene #108098); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:04:09 14

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.